Incidental Mutation 'R5083:Cdc23'
ID387284
Institutional Source Beutler Lab
Gene Symbol Cdc23
Ensembl Gene ENSMUSG00000024370
Gene NameCDC23 cell division cycle 23
SynonymsD18Ertd243e
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34630951-34651735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34651689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 7 (V7L)
Ref Sequence ENSEMBL: ENSMUSP00000122420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181]
Predicted Effect unknown
Transcript: ENSMUST00000025228
AA Change: V7L
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370
AA Change: V7L

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect unknown
Transcript: ENSMUST00000133181
AA Change: V7L
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370
AA Change: V7L

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151409
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Cdc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cdc23 APN 18 34636332 missense probably benign 0.01
IGL01302:Cdc23 APN 18 34634644 missense probably benign 0.19
IGL01859:Cdc23 APN 18 34651406 missense probably benign 0.01
IGL02307:Cdc23 APN 18 34641389 missense possibly damaging 0.71
IGL03081:Cdc23 APN 18 34636704 missense probably damaging 1.00
IGL03086:Cdc23 APN 18 34637186 unclassified probably benign
IGL03089:Cdc23 APN 18 34634460 missense probably damaging 1.00
IGL03249:Cdc23 APN 18 34644016 splice site probably benign
R0217:Cdc23 UTSW 18 34651665 missense unknown
R0790:Cdc23 UTSW 18 34651613 missense possibly damaging 0.94
R1593:Cdc23 UTSW 18 34636326 missense possibly damaging 0.88
R2929:Cdc23 UTSW 18 34637318 frame shift probably null
R2930:Cdc23 UTSW 18 34637318 frame shift probably null
R3963:Cdc23 UTSW 18 34646919 missense probably benign 0.01
R3983:Cdc23 UTSW 18 34637486 unclassified probably benign
R4245:Cdc23 UTSW 18 34637047 unclassified probably benign
R4415:Cdc23 UTSW 18 34637318 frame shift probably null
R4417:Cdc23 UTSW 18 34637318 frame shift probably null
R4992:Cdc23 UTSW 18 34646919 missense probably benign
R5037:Cdc23 UTSW 18 34651689 missense unknown
R5071:Cdc23 UTSW 18 34651689 missense unknown
R5072:Cdc23 UTSW 18 34651689 missense unknown
R5073:Cdc23 UTSW 18 34651689 missense unknown
R5074:Cdc23 UTSW 18 34651689 missense unknown
R5081:Cdc23 UTSW 18 34651689 missense unknown
R5082:Cdc23 UTSW 18 34651689 missense unknown
R5110:Cdc23 UTSW 18 34651689 missense unknown
R5111:Cdc23 UTSW 18 34651689 missense unknown
R5122:Cdc23 UTSW 18 34651689 missense unknown
R5131:Cdc23 UTSW 18 34651689 missense unknown
R5132:Cdc23 UTSW 18 34651689 missense unknown
R5166:Cdc23 UTSW 18 34651689 missense unknown
R7186:Cdc23 UTSW 18 34637122 missense probably damaging 1.00
R7359:Cdc23 UTSW 18 34641341 missense probably benign 0.40
R7732:Cdc23 UTSW 18 34636702 critical splice donor site probably null
R7832:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R7915:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R8031:Cdc23 UTSW 18 34651688 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACGGTGCCCTTACCTCTG -3'
(R):5'- GCCAATCAGGATCTAACTGTCTC -3'

Sequencing Primer
(F):5'- TGCAGCTCCGACAAAGG -3'
(R):5'- AATCAGGATCTAACTGTCTCTTTTCC -3'
Posted On2016-06-06