Incidental Mutation 'R5084:Olfr1333'
ID 387292
Institutional Source Beutler Lab
Gene Symbol Olfr1333
Ensembl Gene ENSMUSG00000110947
Gene Name olfactory receptor 1333
Synonyms MOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6
MMRRC Submission 042673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R5084 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118827659-118836279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118829570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 290 (V290A)
Ref Sequence ENSEMBL: ENSMUSP00000075398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000106361] [ENSMUST00000214477]
AlphaFold Q7TQV7
Predicted Effect probably damaging
Transcript: ENSMUST00000076019
AA Change: V290A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: V290A

DomainStartEndE-ValueType
Pfam:7tm_1 42 291 4.1e-31 PFAM
Pfam:7tm_4 140 284 2.9e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106361
AA Change: V291A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: V291A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: V289A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214477
AA Change: V289A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,326,917 E59D probably damaging Het
Akap7 T A 10: 25,279,742 probably benign Het
Anpep C A 7: 79,826,870 probably null Het
Aste1 T A 9: 105,397,687 Y314* probably null Het
Ccdc183 G A 2: 25,608,790 T497I probably damaging Het
Cd4 A T 6: 124,870,439 I254N probably damaging Het
Crot G T 5: 8,969,994 H449Q probably damaging Het
Dact2 A T 17: 14,197,952 W164R possibly damaging Het
Dapk3 C A 10: 81,190,318 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbrsl1 G A 5: 110,379,406 probably benign Het
Flg T C 3: 93,277,615 F15L probably damaging Het
Fscn2 A G 11: 120,361,860 D51G probably damaging Het
H2-Ob G T 17: 34,241,128 G71V probably damaging Het
Hmgcs1 T C 13: 119,699,984 V104A possibly damaging Het
Hs3st4 G T 7: 124,397,295 D395Y probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ldlrad3 G A 2: 102,069,984 R58C probably damaging Het
Lpin1 A G 12: 16,576,982 S188P probably damaging Het
Mamdc2 G T 19: 23,359,152 T331K possibly damaging Het
Matr3 G A 18: 35,582,082 S195N probably damaging Het
Nktr T C 9: 121,748,110 Y390H possibly damaging Het
Notch3 C T 17: 32,157,890 probably null Het
Olfm3 T C 3: 114,904,553 probably null Het
Olfr193 C T 16: 59,110,073 C179Y possibly damaging Het
Olfr434 T C 6: 43,217,660 L249P probably damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Olfr866 T A 9: 20,027,255 I228F probably damaging Het
Pask A G 1: 93,322,097 V527A probably benign Het
Pcdha6 A T 18: 36,968,963 N403I probably damaging Het
Peg3 T C 7: 6,707,849 E1458G probably damaging Het
Pip4k2b G A 11: 97,719,743 T386M probably damaging Het
Pkd1l1 T C 11: 8,942,004 M272V probably benign Het
Plcb4 A G 2: 136,002,651 E163G probably damaging Het
Plk5 C A 10: 80,358,889 R149S possibly damaging Het
Pou4f3 A T 18: 42,395,868 Y292F probably damaging Het
Rasgef1c A G 11: 49,969,505 K272E probably damaging Het
Rbl2 C T 8: 91,115,131 T942M probably benign Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Smarca4 T C 9: 21,660,763 L777P probably damaging Het
Smpd1 T C 7: 105,556,978 Y438H probably damaging Het
Sorl1 T C 9: 41,976,377 K2052R probably benign Het
Spata31d1c C A 13: 65,035,130 P162Q probably damaging Het
Ston1 A T 17: 88,636,574 E469D probably benign Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Syde2 AGTTC AGTTCGTTC 3: 146,001,409 probably null Het
Taar5 T A 10: 23,970,938 L78Q probably damaging Het
Tas2r114 A T 6: 131,689,288 L259* probably null Het
Tex37 A G 6: 70,915,704 S20P possibly damaging Het
Topaz1 T A 9: 122,748,818 H264Q probably benign Het
Vcl G T 14: 21,008,959 V548L possibly damaging Het
Vmn2r57 C A 7: 41,426,550 probably null Het
Vmn2r92 A G 17: 18,185,177 *861W probably null Het
Ylpm1 T G 12: 85,029,321 V940G probably damaging Het
Zfp236 A G 18: 82,609,431 S1500P probably damaging Het
Zfp384 G T 6: 125,023,679 probably benign Het
Zfp786 T C 6: 47,820,019 M662V probably benign Het
Other mutations in Olfr1333
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Olfr1333 APN 4 118829792 missense probably benign 0.30
IGL03023:Olfr1333 APN 4 118830252 missense probably damaging 0.99
IGL03387:Olfr1333 APN 4 118830041 missense probably damaging 1.00
R0326:Olfr1333 UTSW 4 118829825 missense possibly damaging 0.90
R0532:Olfr1333 UTSW 4 118829700 missense probably damaging 1.00
R1775:Olfr1333 UTSW 4 118829868 missense probably benign 0.00
R1906:Olfr1333 UTSW 4 118830270 missense probably damaging 1.00
R1946:Olfr1333 UTSW 4 118830026 missense probably benign 0.00
R2260:Olfr1333 UTSW 4 118830162 missense probably damaging 1.00
R5337:Olfr1333 UTSW 4 118829666 missense probably benign 0.44
R5444:Olfr1333 UTSW 4 118830111 missense probably benign
R5817:Olfr1333 UTSW 4 118830099 missense probably damaging 0.96
R5973:Olfr1333 UTSW 4 118830216 missense probably benign 0.22
R5987:Olfr1333 UTSW 4 118830281 missense probably damaging 0.96
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R6031:Olfr1333 UTSW 4 118830391 splice site probably null
R7255:Olfr1333 UTSW 4 118829952 missense probably benign 0.17
R7483:Olfr1333 UTSW 4 118830320 missense probably damaging 0.98
R8214:Olfr1333 UTSW 4 118830091 missense probably benign
R8479:Olfr1333 UTSW 4 118830015 missense probably damaging 1.00
R8847:Olfr1333 UTSW 4 118829624 missense probably damaging 0.97
Z1176:Olfr1333 UTSW 4 118830050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTGTCTTTCAGGAATGTTGTC -3'
(R):5'- CAAGATCAAGTCCACAGAGGGC -3'

Sequencing Primer
(F):5'- CTGTCTTTCAGGAATGTTGTCCTAAG -3'
(R):5'- CCGCTGCAAGGCTTTCTCTAC -3'
Posted On 2016-06-06