Mutagenetix > Incidental Mutation

Incidental Mutation 'R5084:Olfr1333'

387292

Institutional Source

Beutler Lab

Gene Symbol

Olfr1333

Ensembl Gene

ENSMUSG00000110947

Gene Name

olfactory receptor 1333

Synonyms

MOR259-11, GA_x6K02T2QD9B-18703033-18703986, MOR259-6

MMRRC Submission

042673-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R5084 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118827659-118836279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118829570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 290 (V290A)

Ref Sequence

ENSEMBL: ENSMUSP00000075398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076019] [ENSMUST00000106361] [ENSMUST00000214477]

AlphaFold

Q7TQV7

Predicted Effect

probably damaging
Transcript: ENSMUST00000076019
AA Change: V290A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000075398
Gene: ENSMUSG00000110947
AA Change: V290A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	42	291	4.1e-31	PFAM
Pfam:7tm_4	140	284	2.9e-46	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106361
AA Change: V291A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: V291A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	309	6.1e-56	PFAM
Pfam:7tm_1	43	292	3.9e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214477
AA Change: V289A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214477
AA Change: V289A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acpp	T	A	9: 104,326,917	E59D	probably damaging	Het
Akap7	T	A	10: 25,279,742		probably benign	Het
Anpep	C	A	7: 79,826,870		probably null	Het
Aste1	T	A	9: 105,397,687	Y314*	probably null	Het
Ccdc183	G	A	2: 25,608,790	T497I	probably damaging	Het
Cd4	A	T	6: 124,870,439	I254N	probably damaging	Het
Crot	G	T	5: 8,969,994	H449Q	probably damaging	Het
Dact2	A	T	17: 14,197,952	W164R	possibly damaging	Het
Dapk3	C	A	10: 81,190,318		probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Fbrsl1	G	A	5: 110,379,406		probably benign	Het
Flg	T	C	3: 93,277,615	F15L	probably damaging	Het
Fscn2	A	G	11: 120,361,860	D51G	probably damaging	Het
H2-Ob	G	T	17: 34,241,128	G71V	probably damaging	Het
Hmgcs1	T	C	13: 119,699,984	V104A	possibly damaging	Het
Hs3st4	G	T	7: 124,397,295	D395Y	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Ldlrad3	G	A	2: 102,069,984	R58C	probably damaging	Het
Lpin1	A	G	12: 16,576,982	S188P	probably damaging	Het
Mamdc2	G	T	19: 23,359,152	T331K	possibly damaging	Het
Matr3	G	A	18: 35,582,082	S195N	probably damaging	Het
Nktr	T	C	9: 121,748,110	Y390H	possibly damaging	Het
Notch3	C	T	17: 32,157,890		probably null	Het
Olfm3	T	C	3: 114,904,553		probably null	Het
Olfr193	C	T	16: 59,110,073	C179Y	possibly damaging	Het
Olfr434	T	C	6: 43,217,660	L249P	probably damaging	Het
Olfr829	T	A	9: 18,857,336	M237K	probably benign	Het
Olfr866	T	A	9: 20,027,255	I228F	probably damaging	Het
Pask	A	G	1: 93,322,097	V527A	probably benign	Het
Pcdha6	A	T	18: 36,968,963	N403I	probably damaging	Het
Peg3	T	C	7: 6,707,849	E1458G	probably damaging	Het
Pip4k2b	G	A	11: 97,719,743	T386M	probably damaging	Het
Pkd1l1	T	C	11: 8,942,004	M272V	probably benign	Het
Plcb4	A	G	2: 136,002,651	E163G	probably damaging	Het
Plk5	C	A	10: 80,358,889	R149S	possibly damaging	Het
Pou4f3	A	T	18: 42,395,868	Y292F	probably damaging	Het
Rasgef1c	A	G	11: 49,969,505	K272E	probably damaging	Het
Rbl2	C	T	8: 91,115,131	T942M	probably benign	Het
Sipa1l3	G	A	7: 29,348,575	S247F	probably damaging	Het
Smarca4	T	C	9: 21,660,763	L777P	probably damaging	Het
Smpd1	T	C	7: 105,556,978	Y438H	probably damaging	Het
Sorl1	T	C	9: 41,976,377	K2052R	probably benign	Het
Spata31d1c	C	A	13: 65,035,130	P162Q	probably damaging	Het
Ston1	A	T	17: 88,636,574	E469D	probably benign	Het
Syde2	CAGTT	CAGTTAGTT	3: 146,001,408		probably null	Het
Syde2	AGTTC	AGTTCGTTC	3: 146,001,409		probably null	Het
Taar5	T	A	10: 23,970,938	L78Q	probably damaging	Het
Tas2r114	A	T	6: 131,689,288	L259*	probably null	Het
Tex37	A	G	6: 70,915,704	S20P	possibly damaging	Het
Topaz1	T	A	9: 122,748,818	H264Q	probably benign	Het
Vcl	G	T	14: 21,008,959	V548L	possibly damaging	Het
Vmn2r57	C	A	7: 41,426,550		probably null	Het
Vmn2r92	A	G	17: 18,185,177	*861W	probably null	Het
Ylpm1	T	G	12: 85,029,321	V940G	probably damaging	Het
Zfp236	A	G	18: 82,609,431	S1500P	probably damaging	Het
Zfp384	G	T	6: 125,023,679		probably benign	Het
Zfp786	T	C	6: 47,820,019	M662V	probably benign	Het

Other mutations in Olfr1333

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Olfr1333	APN	4	118829792	missense	probably benign	0.30
IGL03023:Olfr1333	APN	4	118830252	missense	probably damaging	0.99
IGL03387:Olfr1333	APN	4	118830041	missense	probably damaging	1.00
R0326:Olfr1333	UTSW	4	118829825	missense	possibly damaging	0.90
R0532:Olfr1333	UTSW	4	118829700	missense	probably damaging	1.00
R1775:Olfr1333	UTSW	4	118829868	missense	probably benign	0.00
R1906:Olfr1333	UTSW	4	118830270	missense	probably damaging	1.00
R1946:Olfr1333	UTSW	4	118830026	missense	probably benign	0.00
R2260:Olfr1333	UTSW	4	118830162	missense	probably damaging	1.00
R5337:Olfr1333	UTSW	4	118829666	missense	probably benign	0.44
R5444:Olfr1333	UTSW	4	118830111	missense	probably benign
R5817:Olfr1333	UTSW	4	118830099	missense	probably damaging	0.96
R5973:Olfr1333	UTSW	4	118830216	missense	probably benign	0.22
R5987:Olfr1333	UTSW	4	118830281	missense	probably damaging	0.96
R6031:Olfr1333	UTSW	4	118830391	splice site	probably null
R6031:Olfr1333	UTSW	4	118830391	splice site	probably null
R7255:Olfr1333	UTSW	4	118829952	missense	probably benign	0.17
R7483:Olfr1333	UTSW	4	118830320	missense	probably damaging	0.98
R8214:Olfr1333	UTSW	4	118830091	missense	probably benign
R8479:Olfr1333	UTSW	4	118830015	missense	probably damaging	1.00
R8847:Olfr1333	UTSW	4	118829624	missense	probably damaging	0.97
R9661:Olfr1333	UTSW	4	118830329	missense	probably benign	0.45
Z1176:Olfr1333	UTSW	4	118830050	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCTGTCTTTCAGGAATGTTGTC -3'
(R):5'- CAAGATCAAGTCCACAGAGGGC -3'

Sequencing Primer
(F):5'- CTGTCTTTCAGGAATGTTGTCCTAAG -3'
(R):5'- CCGCTGCAAGGCTTTCTCTAC -3'

Posted On

2016-06-06