Incidental Mutation 'R5084:Tas2r114'
ID 387303
Institutional Source Beutler Lab
Gene Symbol Tas2r114
Ensembl Gene ENSMUSG00000063478
Gene Name taste receptor, type 2, member 114
Synonyms mt2r46, mGR14, T2R14, Tas2r14
MMRRC Submission 042673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R5084 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 131689134-131690063 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 131689288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 259 (L259*)
Ref Sequence ENSEMBL: ENSMUSP00000079453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M722
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080619
AA Change: L259*
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: L259*

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,326,917 E59D probably damaging Het
Akap7 T A 10: 25,279,742 probably benign Het
Anpep C A 7: 79,826,870 probably null Het
Aste1 T A 9: 105,397,687 Y314* probably null Het
Ccdc183 G A 2: 25,608,790 T497I probably damaging Het
Cd4 A T 6: 124,870,439 I254N probably damaging Het
Crot G T 5: 8,969,994 H449Q probably damaging Het
Dact2 A T 17: 14,197,952 W164R possibly damaging Het
Dapk3 C A 10: 81,190,318 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbrsl1 G A 5: 110,379,406 probably benign Het
Flg T C 3: 93,277,615 F15L probably damaging Het
Fscn2 A G 11: 120,361,860 D51G probably damaging Het
H2-Ob G T 17: 34,241,128 G71V probably damaging Het
Hmgcs1 T C 13: 119,699,984 V104A possibly damaging Het
Hs3st4 G T 7: 124,397,295 D395Y probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ldlrad3 G A 2: 102,069,984 R58C probably damaging Het
Lpin1 A G 12: 16,576,982 S188P probably damaging Het
Mamdc2 G T 19: 23,359,152 T331K possibly damaging Het
Matr3 G A 18: 35,582,082 S195N probably damaging Het
Nktr T C 9: 121,748,110 Y390H possibly damaging Het
Notch3 C T 17: 32,157,890 probably null Het
Olfm3 T C 3: 114,904,553 probably null Het
Olfr1333 A G 4: 118,829,570 V290A probably damaging Het
Olfr193 C T 16: 59,110,073 C179Y possibly damaging Het
Olfr434 T C 6: 43,217,660 L249P probably damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Olfr866 T A 9: 20,027,255 I228F probably damaging Het
Pask A G 1: 93,322,097 V527A probably benign Het
Pcdha6 A T 18: 36,968,963 N403I probably damaging Het
Peg3 T C 7: 6,707,849 E1458G probably damaging Het
Pip4k2b G A 11: 97,719,743 T386M probably damaging Het
Pkd1l1 T C 11: 8,942,004 M272V probably benign Het
Plcb4 A G 2: 136,002,651 E163G probably damaging Het
Plk5 C A 10: 80,358,889 R149S possibly damaging Het
Pou4f3 A T 18: 42,395,868 Y292F probably damaging Het
Rasgef1c A G 11: 49,969,505 K272E probably damaging Het
Rbl2 C T 8: 91,115,131 T942M probably benign Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Smarca4 T C 9: 21,660,763 L777P probably damaging Het
Smpd1 T C 7: 105,556,978 Y438H probably damaging Het
Sorl1 T C 9: 41,976,377 K2052R probably benign Het
Spata31d1c C A 13: 65,035,130 P162Q probably damaging Het
Ston1 A T 17: 88,636,574 E469D probably benign Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Syde2 AGTTC AGTTCGTTC 3: 146,001,409 probably null Het
Taar5 T A 10: 23,970,938 L78Q probably damaging Het
Tex37 A G 6: 70,915,704 S20P possibly damaging Het
Topaz1 T A 9: 122,748,818 H264Q probably benign Het
Vcl G T 14: 21,008,959 V548L possibly damaging Het
Vmn2r57 C A 7: 41,426,550 probably null Het
Vmn2r92 A G 17: 18,185,177 *861W probably null Het
Ylpm1 T G 12: 85,029,321 V940G probably damaging Het
Zfp236 A G 18: 82,609,431 S1500P probably damaging Het
Zfp384 G T 6: 125,023,679 probably benign Het
Zfp786 T C 6: 47,820,019 M662V probably benign Het
Other mutations in Tas2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Tas2r114 APN 6 131689701 nonsense probably null
IGL02971:Tas2r114 APN 6 131689280 missense probably benign 0.00
R0561:Tas2r114 UTSW 6 131689795 missense probably benign 0.30
R3034:Tas2r114 UTSW 6 131689648 missense probably benign 0.15
R3687:Tas2r114 UTSW 6 131689268 missense probably benign 0.25
R4411:Tas2r114 UTSW 6 131689622 missense probably benign 0.06
R4826:Tas2r114 UTSW 6 131689837 missense probably damaging 0.99
R4889:Tas2r114 UTSW 6 131689795 missense probably damaging 0.96
R5258:Tas2r114 UTSW 6 131689541 missense probably benign 0.03
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6499:Tas2r114 UTSW 6 131689136 makesense probably null
R7164:Tas2r114 UTSW 6 131689765 missense possibly damaging 0.74
R7276:Tas2r114 UTSW 6 131689347 missense probably damaging 0.96
R7745:Tas2r114 UTSW 6 131689438 missense probably damaging 1.00
R7851:Tas2r114 UTSW 6 131689925 missense probably damaging 1.00
R8002:Tas2r114 UTSW 6 131689139 missense probably damaging 1.00
R8901:Tas2r114 UTSW 6 131689951 missense probably damaging 0.99
R9297:Tas2r114 UTSW 6 131689324 missense probably damaging 0.96
R9380:Tas2r114 UTSW 6 131689418 missense probably benign 0.00
R9402:Tas2r114 UTSW 6 131689931 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCATAGTGCAAGTGAAAAGATCTTC -3'
(R):5'- TCACTTTGGAGACATCGCAG -3'

Sequencing Primer
(F):5'- CAATTCCAGATTGCATGTGTTCCAG -3'
(R):5'- CATCGCAGGCAGATGGAATC -3'
Posted On 2016-06-06