Incidental Mutation 'R5084:Smpd1'
ID387309
Institutional Source Beutler Lab
Gene Symbol Smpd1
Ensembl Gene ENSMUSG00000037049
Gene Namesphingomyelin phosphodiesterase 1, acid lysosomal
SynonymsASM, aSMase, A-SMase, acid sphingomyelinase, Zn-SMase
MMRRC Submission 042673-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5084 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105554360-105558389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105556978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 438 (Y438H)
Ref Sequence ENSEMBL: ENSMUSP00000042187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046983] [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000187057] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601]
Predicted Effect probably damaging
Transcript: ENSMUST00000046983
AA Change: Y438H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042187
Gene: ENSMUSG00000037049
AA Change: Y438H

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
SapB 85 163 1.05e-7 SMART
low complexity region 177 196 N/A INTRINSIC
Pfam:Metallophos 197 459 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081165
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191011
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably benign
Transcript: ENSMUST00000191601
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211307
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal acid sphingomyelinase that converts sphingomyelin to ceramide. The encoded protein also has phospholipase C activity. Defects in this gene are a cause of Niemann-Pick disease type A (NPA) and Niemann-Pick disease type B (NPB). Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
PHENOTYPE: Nullizygous mutations cause tremors, ataxia, altered lipid homeostasis, increased foam cell number, Purkinje cell loss and premature death, and may lead to hepatosplenomegaly, hunched posture, reduced weight, abnormal apoptosis, sperm defects, dyspnea, and high susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,326,917 E59D probably damaging Het
Akap7 T A 10: 25,279,742 probably benign Het
Anpep C A 7: 79,826,870 probably null Het
Aste1 T A 9: 105,397,687 Y314* probably null Het
Ccdc183 G A 2: 25,608,790 T497I probably damaging Het
Cd4 A T 6: 124,870,439 I254N probably damaging Het
Crot G T 5: 8,969,994 H449Q probably damaging Het
Dact2 A T 17: 14,197,952 W164R possibly damaging Het
Dapk3 C A 10: 81,190,318 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbrsl1 G A 5: 110,379,406 probably benign Het
Flg T C 3: 93,277,615 F15L probably damaging Het
Fscn2 A G 11: 120,361,860 D51G probably damaging Het
H2-Ob G T 17: 34,241,128 G71V probably damaging Het
Hmgcs1 T C 13: 119,699,984 V104A possibly damaging Het
Hs3st4 G T 7: 124,397,295 D395Y probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ldlrad3 G A 2: 102,069,984 R58C probably damaging Het
Lpin1 A G 12: 16,576,982 S188P probably damaging Het
Mamdc2 G T 19: 23,359,152 T331K possibly damaging Het
Matr3 G A 18: 35,582,082 S195N probably damaging Het
Nktr T C 9: 121,748,110 Y390H possibly damaging Het
Notch3 C T 17: 32,157,890 probably null Het
Olfm3 T C 3: 114,904,553 probably null Het
Olfr1333 A G 4: 118,829,570 V290A probably damaging Het
Olfr193 C T 16: 59,110,073 C179Y possibly damaging Het
Olfr434 T C 6: 43,217,660 L249P probably damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Olfr866 T A 9: 20,027,255 I228F probably damaging Het
Pask A G 1: 93,322,097 V527A probably benign Het
Pcdha6 A T 18: 36,968,963 N403I probably damaging Het
Peg3 T C 7: 6,707,849 E1458G probably damaging Het
Pip4k2b G A 11: 97,719,743 T386M probably damaging Het
Pkd1l1 T C 11: 8,942,004 M272V probably benign Het
Plcb4 A G 2: 136,002,651 E163G probably damaging Het
Plk5 C A 10: 80,358,889 R149S possibly damaging Het
Pou4f3 A T 18: 42,395,868 Y292F probably damaging Het
Rasgef1c A G 11: 49,969,505 K272E probably damaging Het
Rbl2 C T 8: 91,115,131 T942M probably benign Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Smarca4 T C 9: 21,660,763 L777P probably damaging Het
Sorl1 T C 9: 41,976,377 K2052R probably benign Het
Spata31d1c C A 13: 65,035,130 P162Q probably damaging Het
Ston1 A T 17: 88,636,574 E469D probably benign Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Syde2 AGTTC AGTTCGTTC 3: 146,001,409 probably null Het
Taar5 T A 10: 23,970,938 L78Q probably damaging Het
Tas2r114 A T 6: 131,689,288 L259* probably null Het
Tex37 A G 6: 70,915,704 S20P possibly damaging Het
Topaz1 T A 9: 122,748,818 H264Q probably benign Het
Vcl G T 14: 21,008,959 V548L possibly damaging Het
Vmn2r57 C A 7: 41,426,550 probably null Het
Vmn2r92 A G 17: 18,185,177 *861W probably null Het
Ylpm1 T G 12: 85,029,321 V940G probably damaging Het
Zfp236 A G 18: 82,609,431 S1500P probably damaging Het
Zfp384 G T 6: 125,023,679 probably benign Het
Zfp786 T C 6: 47,820,019 M662V probably benign Het
Other mutations in Smpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Smpd1 APN 7 105556641 missense probably damaging 0.99
IGL01147:Smpd1 APN 7 105555736 missense probably damaging 1.00
IGL01526:Smpd1 APN 7 105554775 missense probably benign 0.01
IGL01541:Smpd1 APN 7 105555826 missense possibly damaging 0.48
IGL01619:Smpd1 APN 7 105555342 missense possibly damaging 0.89
IGL01924:Smpd1 APN 7 105555448 missense probably benign 0.01
IGL03004:Smpd1 APN 7 105556674 missense possibly damaging 0.82
R0782:Smpd1 UTSW 7 105555343 missense possibly damaging 0.80
R1445:Smpd1 UTSW 7 105556674 missense possibly damaging 0.82
R1489:Smpd1 UTSW 7 105556554 unclassified probably null
R3683:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3685:Smpd1 UTSW 7 105555402 missense probably damaging 1.00
R3977:Smpd1 UTSW 7 105555901 missense probably benign 0.29
R4850:Smpd1 UTSW 7 105555985 missense probably benign
R6316:Smpd1 UTSW 7 105555502 missense probably benign 0.19
R6429:Smpd1 UTSW 7 105556928 missense probably damaging 1.00
R6672:Smpd1 UTSW 7 105555273 missense probably benign
R7156:Smpd1 UTSW 7 105554486 unclassified probably benign
R7883:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
R7966:Smpd1 UTSW 7 105556985 missense probably damaging 1.00
X0021:Smpd1 UTSW 7 105557645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTACTGTCTTCCCTGGGTC -3'
(R):5'- CCAGATTGTGAGACTCTGTGC -3'

Sequencing Primer
(F):5'- GGGTCCATGTTCACCTTCCTG -3'
(R):5'- ACTCTGTGCTTGAGGGAATTGC -3'
Posted On2016-06-06