Incidental Mutation 'R0427:Cfap74'
ID38731
Institutional Source Beutler Lab
Gene Symbol Cfap74
Ensembl Gene ENSMUSG00000078490
Gene Namecilia and flagella associated protein 74
Synonyms2010015L04Rik
MMRRC Submission 038629-MU
Accession Numbers

NCBI RefSeq: isoform 1: NM_177674.5; isoform 2: NM_001166029.1; MGI: 1917130

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155409190-155466823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155441277 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 728 (M728L)
Ref Sequence ENSEMBL: ENSMUSP00000123626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151083]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094408
SMART Domains Protein: ENSMUSP00000091975
Gene: ENSMUSG00000042233

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151083
AA Change: M728L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123626
Gene: ENSMUSG00000078490
AA Change: M728L

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165947
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Med27 T C 2: 29,500,271 I70T probably damaging Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Cfap74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Cfap74 APN 4 155418986 missense possibly damaging 0.95
paranoid UTSW 4 155454024 utr 5 prime probably benign
sensibile UTSW 4 155441286 missense probably null 0.03
touchy UTSW 4 155463072 missense probably benign 0.27
FR4304:Cfap74 UTSW 4 155415760 missense possibly damaging 0.93
P0007:Cfap74 UTSW 4 155422228 missense possibly damaging 0.83
PIT4434001:Cfap74 UTSW 4 155463964 missense unknown
R0025:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0034:Cfap74 UTSW 4 155460887 splice site probably benign
R0193:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0306:Cfap74 UTSW 4 155465439 unclassified probably benign
R0905:Cfap74 UTSW 4 155418696 critical splice donor site probably null
R1116:Cfap74 UTSW 4 155433996 missense probably benign 0.15
R1548:Cfap74 UTSW 4 155434045 missense probably benign 0.45
R1950:Cfap74 UTSW 4 155427430 critical splice donor site probably null
R2009:Cfap74 UTSW 4 155420267 missense possibly damaging 0.77
R2029:Cfap74 UTSW 4 155442081 missense possibly damaging 0.74
R2135:Cfap74 UTSW 4 155429940 missense probably damaging 0.97
R2135:Cfap74 UTSW 4 155429951 missense probably damaging 1.00
R2154:Cfap74 UTSW 4 155429296 missense possibly damaging 0.94
R2413:Cfap74 UTSW 4 155418624 missense possibly damaging 0.76
R2418:Cfap74 UTSW 4 155455709 utr 5 prime probably benign
R2930:Cfap74 UTSW 4 155438170 missense probably damaging 0.97
R3965:Cfap74 UTSW 4 155446717 missense probably damaging 1.00
R4078:Cfap74 UTSW 4 155455671 missense probably damaging 0.98
R4238:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4239:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4240:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4491:Cfap74 UTSW 4 155429171 missense probably benign 0.22
R4731:Cfap74 UTSW 4 155463602 intron probably benign
R5333:Cfap74 UTSW 4 155436740 missense probably damaging 0.99
R5362:Cfap74 UTSW 4 155438166 missense probably damaging 0.98
R5425:Cfap74 UTSW 4 155455692 utr 5 prime probably benign
R5468:Cfap74 UTSW 4 155426041 missense probably benign 0.27
R5839:Cfap74 UTSW 4 155422750 critical splice donor site probably null
R6010:Cfap74 UTSW 4 155454038 missense possibly damaging 0.83
R6284:Cfap74 UTSW 4 155451796 missense probably damaging 0.96
R6323:Cfap74 UTSW 4 155463938 missense possibly damaging 0.54
R6389:Cfap74 UTSW 4 155423336 missense possibly damaging 0.69
R6513:Cfap74 UTSW 4 155441286 missense probably null 0.03
R6527:Cfap74 UTSW 4 155422265 unclassified probably null
R6785:Cfap74 UTSW 4 155454024 utr 5 prime probably benign
R6980:Cfap74 UTSW 4 155466352 unclassified probably benign
R7039:Cfap74 UTSW 4 155454108 critical splice donor site probably null
R7077:Cfap74 UTSW 4 155455677 missense unknown
R7116:Cfap74 UTSW 4 155455061 missense unknown
R7202:Cfap74 UTSW 4 155426197 splice site probably null
R7227:Cfap74 UTSW 4 155460948 nonsense probably null
R7228:Cfap74 UTSW 4 155465050 missense unknown
R7261:Cfap74 UTSW 4 155465374 missense unknown
R7315:Cfap74 UTSW 4 155463019 missense unknown
R7337:Cfap74 UTSW 4 155460015 missense unknown
R7354:Cfap74 UTSW 4 155465347 missense unknown
R7533:Cfap74 UTSW 4 155415743 missense
T0970:Cfap74 UTSW 4 155463117 splice site probably null
X0066:Cfap74 UTSW 4 155463964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- cacgcacacacacacaAAGTCAG -3'
(R):5'- CGTTCGACATGGGGAAGGGGATA -3'

Sequencing Primer
(F):5'- ggaaacagaggcaggcag -3'
(R):5'- CATGGGGAAGGGGATACATTG -3'
Posted On2013-05-23