Incidental Mutation 'R5084:Lpin1'
ID387332
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 042673-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R5084 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16576982 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 188 (S188P)
Ref Sequence ENSEMBL: ENSMUSP00000152276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221146] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect probably damaging
Transcript: ENSMUST00000067124
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: S188P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111067
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: S188P

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221146
Predicted Effect probably damaging
Transcript: ENSMUST00000221230
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221297
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222989
AA Change: S188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,326,917 E59D probably damaging Het
Akap7 T A 10: 25,279,742 probably benign Het
Anpep C A 7: 79,826,870 probably null Het
Aste1 T A 9: 105,397,687 Y314* probably null Het
Ccdc183 G A 2: 25,608,790 T497I probably damaging Het
Cd4 A T 6: 124,870,439 I254N probably damaging Het
Crot G T 5: 8,969,994 H449Q probably damaging Het
Dact2 A T 17: 14,197,952 W164R possibly damaging Het
Dapk3 C A 10: 81,190,318 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbrsl1 G A 5: 110,379,406 probably benign Het
Flg T C 3: 93,277,615 F15L probably damaging Het
Fscn2 A G 11: 120,361,860 D51G probably damaging Het
H2-Ob G T 17: 34,241,128 G71V probably damaging Het
Hmgcs1 T C 13: 119,699,984 V104A possibly damaging Het
Hs3st4 G T 7: 124,397,295 D395Y probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ldlrad3 G A 2: 102,069,984 R58C probably damaging Het
Mamdc2 G T 19: 23,359,152 T331K possibly damaging Het
Matr3 G A 18: 35,582,082 S195N probably damaging Het
Nktr T C 9: 121,748,110 Y390H possibly damaging Het
Notch3 C T 17: 32,157,890 probably null Het
Olfm3 T C 3: 114,904,553 probably null Het
Olfr1333 A G 4: 118,829,570 V290A probably damaging Het
Olfr193 C T 16: 59,110,073 C179Y possibly damaging Het
Olfr434 T C 6: 43,217,660 L249P probably damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Olfr866 T A 9: 20,027,255 I228F probably damaging Het
Pask A G 1: 93,322,097 V527A probably benign Het
Pcdha6 A T 18: 36,968,963 N403I probably damaging Het
Peg3 T C 7: 6,707,849 E1458G probably damaging Het
Pip4k2b G A 11: 97,719,743 T386M probably damaging Het
Pkd1l1 T C 11: 8,942,004 M272V probably benign Het
Plcb4 A G 2: 136,002,651 E163G probably damaging Het
Plk5 C A 10: 80,358,889 R149S possibly damaging Het
Pou4f3 A T 18: 42,395,868 Y292F probably damaging Het
Rasgef1c A G 11: 49,969,505 K272E probably damaging Het
Rbl2 C T 8: 91,115,131 T942M probably benign Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Smarca4 T C 9: 21,660,763 L777P probably damaging Het
Smpd1 T C 7: 105,556,978 Y438H probably damaging Het
Sorl1 T C 9: 41,976,377 K2052R probably benign Het
Spata31d1c C A 13: 65,035,130 P162Q probably damaging Het
Ston1 A T 17: 88,636,574 E469D probably benign Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Syde2 AGTTC AGTTCGTTC 3: 146,001,409 probably null Het
Taar5 T A 10: 23,970,938 L78Q probably damaging Het
Tas2r114 A T 6: 131,689,288 L259* probably null Het
Tex37 A G 6: 70,915,704 S20P possibly damaging Het
Topaz1 T A 9: 122,748,818 H264Q probably benign Het
Vcl G T 14: 21,008,959 V548L possibly damaging Het
Vmn2r57 C A 7: 41,426,550 probably null Het
Vmn2r92 A G 17: 18,185,177 *861W probably null Het
Ylpm1 T G 12: 85,029,321 V940G probably damaging Het
Zfp236 A G 18: 82,609,431 S1500P probably damaging Het
Zfp384 G T 6: 125,023,679 probably benign Het
Zfp786 T C 6: 47,820,019 M662V probably benign Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
R7557:Lpin1 UTSW 12 16580792 missense
Predicted Primers PCR Primer
(F):5'- GTCCATGTGCTCCATCCATG -3'
(R):5'- AGAATCAGGTGCCTGGATCC -3'

Sequencing Primer
(F):5'- TGTCCATGTACTCCATCCATG -3'
(R):5'- TGGATCCCACTACAGCTGC -3'
Posted On2016-06-06