Incidental Mutation 'R5085:Rgs19'
ID387354
Institutional Source Beutler Lab
Gene Symbol Rgs19
Ensembl Gene ENSMUSG00000002458
Gene Nameregulator of G-protein signaling 19
Synonyms
MMRRC Submission 042674-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5085 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181688419-181693977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181689543 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 99 (T99M)
Ref Sequence ENSEMBL: ENSMUSP00000129026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000103042] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108778] [ENSMUST00000108779] [ENSMUST00000129745] [ENSMUST00000165416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002532
AA Change: T99M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458
AA Change: T99M

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103042
SMART Domains Protein: ENSMUSP00000099331
Gene: ENSMUSG00000059540

DomainStartEndE-ValueType
TFS2N 7 81 2.51e-25 SMART
low complexity region 114 129 N/A INTRINSIC
TFS2M 136 237 4.14e-51 SMART
ZnF_C2C2 259 298 7.37e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108769
AA Change: T99M

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458
AA Change: T99M

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
AA Change: T77M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458
AA Change: T77M

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
AA Change: T77M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458
AA Change: T77M

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108776
AA Change: T99M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458
AA Change: T99M

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108778
AA Change: T126M

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104408
Gene: ENSMUSG00000002458
AA Change: T126M

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
RGS 117 233 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126844
Predicted Effect probably benign
Transcript: ENSMUST00000129006
SMART Domains Protein: ENSMUSP00000120083
Gene: ENSMUSG00000059540

DomainStartEndE-ValueType
Pfam:Med26 27 77 5.1e-17 PFAM
low complexity region 112 127 N/A INTRINSIC
TFS2M 134 235 4.14e-51 SMART
ZnF_C2C2 257 296 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129686
Predicted Effect probably benign
Transcript: ENSMUST00000129745
SMART Domains Protein: ENSMUSP00000119646
Gene: ENSMUSG00000059540

DomainStartEndE-ValueType
Pfam:Med26 21 73 2.1e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
TFS2M 129 230 4.14e-51 SMART
ZnF_C2C2 252 291 7.37e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Predicted Effect probably benign
Transcript: ENSMUST00000144476
SMART Domains Protein: ENSMUSP00000120723
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
Pfam:RGS 1 49 3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165416
AA Change: T99M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129026
Gene: ENSMUSG00000002458
AA Change: T99M

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G proteins mediate a number of cellular processes. The protein encoded by this gene belongs to the RGS (regulators of G-protein signaling) family and specifically interacts with G protein, GAI3. This protein is a guanosine triphosphatase-activating protein that functions to down-regulate Galpha i/Galpha q-linked signaling. Alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,678,180 S182G probably damaging Het
4930562C15Rik A T 16: 4,835,973 K129* probably null Het
Adamts6 A T 13: 104,307,243 D162V probably damaging Het
Alms1 C A 6: 85,620,732 P1316T possibly damaging Het
AU040320 A T 4: 126,828,871 N394I possibly damaging Het
Cacng8 T C 7: 3,415,580 L416P possibly damaging Het
Ccdc136 T A 6: 29,419,314 N944K probably damaging Het
Clcn1 C T 6: 42,313,880 T896I probably benign Het
Col16a1 A T 4: 130,054,171 Y228F probably damaging Het
Cyfip1 A G 7: 55,898,335 D561G probably benign Het
Ddr1 T A 17: 35,682,775 probably null Het
Dedd2 A T 7: 25,218,986 L48Q probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dph3b-ps A G 13: 106,547,050 noncoding transcript Het
Dppa3 T C 6: 122,629,932 F127S probably damaging Het
Dpy19l4 C T 4: 11,265,943 probably null Het
Flrt3 T C 2: 140,660,257 T484A probably damaging Het
Gldc T C 19: 30,151,536 E179G probably damaging Het
Gm14403 A G 2: 177,508,489 E76G probably benign Het
Gm6421 G A 13: 117,358,433 noncoding transcript Het
Grk5 T C 19: 61,076,684 V262A probably damaging Het
Grp A G 18: 65,880,159 Q132R probably benign Het
Hap1 A G 11: 100,355,711 F123L probably damaging Het
Hrc A G 7: 45,337,021 D532G probably damaging Het
Igsf9b C A 9: 27,317,437 F164L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl1 C T 11: 104,424,342 R290Q probably damaging Het
Kifc2 T A 15: 76,661,296 L81Q probably damaging Het
Klrc3 T C 6: 129,639,575 R160G probably damaging Het
Mal A G 2: 127,640,273 M70T probably benign Het
Mep1a T G 17: 43,478,144 R580S probably damaging Het
Methig1 A T 15: 100,353,249 I14F probably damaging Het
Mrvi1 G T 7: 110,871,493 L672I probably damaging Het
Mtf1 T C 4: 124,821,308 L242P probably damaging Het
Nfkb1 C A 3: 135,603,807 A509S probably benign Het
Olfr1056 A T 2: 86,355,974 M136K probably damaging Het
Olfr133 G A 17: 38,149,112 D175N probably damaging Het
Olfr1352 G T 10: 78,984,094 M101I probably benign Het
Olfr206 A T 16: 59,345,086 I205K probably damaging Het
Olfr753-ps1 C G 17: 37,169,967 S227T probably benign Het
Pabpc2 A T 18: 39,774,582 N300I probably damaging Het
Peg10 C T 6: 4,755,864 probably benign Het
Ppp1r3a T A 6: 14,719,604 D437V probably damaging Het
Prickle1 A G 15: 93,500,902 S682P probably damaging Het
Prkab2 T C 3: 97,672,992 probably benign Het
Pus3 T A 9: 35,565,636 L243Q possibly damaging Het
Ripk2 A G 4: 16,127,663 S360P possibly damaging Het
Rock1 A G 18: 10,140,210 I127T probably damaging Het
Serpinb10 T G 1: 107,542,217 M143R probably damaging Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Skint6 T A 4: 113,236,268 Q226L probably damaging Het
Slc6a19 T C 13: 73,691,753 M137V probably benign Het
Supv3l1 A T 10: 62,435,512 N415K probably benign Het
Tcrg-V7 A T 13: 19,178,428 K96* probably null Het
Tekt4 A G 17: 25,473,775 R192G probably damaging Het
Tshz1 T C 18: 84,013,928 N785S probably benign Het
Usb1 A G 8: 95,344,051 T202A probably damaging Het
Utp18 A T 11: 93,870,537 D348E possibly damaging Het
Vmn1r42 T G 6: 89,844,616 I324L probably benign Het
Wnt8a A T 18: 34,545,603 R157* probably null Het
Ypel1 A G 16: 17,084,608 probably null Het
Zfp235 A G 7: 24,137,121 K31E probably damaging Het
Zhx2 G C 15: 57,822,693 W486S probably damaging Het
Other mutations in Rgs19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Rgs19 APN 2 181689453 missense probably damaging 1.00
IGL01620:Rgs19 APN 2 181689588 missense possibly damaging 0.72
IGL02096:Rgs19 APN 2 181689283 missense probably damaging 1.00
IGL02529:Rgs19 APN 2 181689150 missense probably benign 0.08
IGL03126:Rgs19 APN 2 181691321 missense probably benign 0.00
IGL03235:Rgs19 APN 2 181689732 missense probably benign 0.03
R1969:Rgs19 UTSW 2 181689483 missense probably damaging 1.00
R6083:Rgs19 UTSW 2 181689507 missense probably damaging 1.00
R6852:Rgs19 UTSW 2 181689148 missense possibly damaging 0.71
R7251:Rgs19 UTSW 2 181689748 missense probably benign 0.00
R7535:Rgs19 UTSW 2 181691308 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGATGCCTTCTCGCACACG -3'
(R):5'- CAGCTGTGAAGTCTGGTGAG -3'

Sequencing Primer
(F):5'- ACACGGGAGTCCAGGCTTAC -3'
(R):5'- AAGTCTGGTGAGTATGGCCACC -3'
Posted On2016-06-06