Incidental Mutation 'R5085:AU040320'
ID387361
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
MMRRC Submission 042674-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5085 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126828871 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 394 (N394I)
Ref Sequence ENSEMBL: ENSMUSP00000037802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047431
AA Change: N394I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: N394I

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102607
AA Change: N394I

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: N394I

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102608
AA Change: N394I

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: N394I

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141918
Meta Mutation Damage Score 0.9651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,678,180 S182G probably damaging Het
4930562C15Rik A T 16: 4,835,973 K129* probably null Het
Adamts6 A T 13: 104,307,243 D162V probably damaging Het
Alms1 C A 6: 85,620,732 P1316T possibly damaging Het
Cacng8 T C 7: 3,415,580 L416P possibly damaging Het
Ccdc136 T A 6: 29,419,314 N944K probably damaging Het
Clcn1 C T 6: 42,313,880 T896I probably benign Het
Col16a1 A T 4: 130,054,171 Y228F probably damaging Het
Cyfip1 A G 7: 55,898,335 D561G probably benign Het
Ddr1 T A 17: 35,682,775 probably null Het
Dedd2 A T 7: 25,218,986 L48Q probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dph3b-ps A G 13: 106,547,050 noncoding transcript Het
Dppa3 T C 6: 122,629,932 F127S probably damaging Het
Dpy19l4 C T 4: 11,265,943 probably null Het
Flrt3 T C 2: 140,660,257 T484A probably damaging Het
Gldc T C 19: 30,151,536 E179G probably damaging Het
Gm14403 A G 2: 177,508,489 E76G probably benign Het
Gm6421 G A 13: 117,358,433 noncoding transcript Het
Grk5 T C 19: 61,076,684 V262A probably damaging Het
Grp A G 18: 65,880,159 Q132R probably benign Het
Hap1 A G 11: 100,355,711 F123L probably damaging Het
Hrc A G 7: 45,337,021 D532G probably damaging Het
Igsf9b C A 9: 27,317,437 F164L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl1 C T 11: 104,424,342 R290Q probably damaging Het
Kifc2 T A 15: 76,661,296 L81Q probably damaging Het
Klrc3 T C 6: 129,639,575 R160G probably damaging Het
Mal A G 2: 127,640,273 M70T probably benign Het
Mep1a T G 17: 43,478,144 R580S probably damaging Het
Methig1 A T 15: 100,353,249 I14F probably damaging Het
Mrvi1 G T 7: 110,871,493 L672I probably damaging Het
Mtf1 T C 4: 124,821,308 L242P probably damaging Het
Nfkb1 C A 3: 135,603,807 A509S probably benign Het
Olfr1056 A T 2: 86,355,974 M136K probably damaging Het
Olfr133 G A 17: 38,149,112 D175N probably damaging Het
Olfr1352 G T 10: 78,984,094 M101I probably benign Het
Olfr206 A T 16: 59,345,086 I205K probably damaging Het
Olfr753-ps1 C G 17: 37,169,967 S227T probably benign Het
Pabpc2 A T 18: 39,774,582 N300I probably damaging Het
Peg10 C T 6: 4,755,864 probably benign Het
Ppp1r3a T A 6: 14,719,604 D437V probably damaging Het
Prickle1 A G 15: 93,500,902 S682P probably damaging Het
Prkab2 T C 3: 97,672,992 probably benign Het
Pus3 T A 9: 35,565,636 L243Q possibly damaging Het
Rgs19 G A 2: 181,689,543 T99M possibly damaging Het
Ripk2 A G 4: 16,127,663 S360P possibly damaging Het
Rock1 A G 18: 10,140,210 I127T probably damaging Het
Serpinb10 T G 1: 107,542,217 M143R probably damaging Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Skint6 T A 4: 113,236,268 Q226L probably damaging Het
Slc6a19 T C 13: 73,691,753 M137V probably benign Het
Supv3l1 A T 10: 62,435,512 N415K probably benign Het
Tcrg-V7 A T 13: 19,178,428 K96* probably null Het
Tekt4 A G 17: 25,473,775 R192G probably damaging Het
Tshz1 T C 18: 84,013,928 N785S probably benign Het
Usb1 A G 8: 95,344,051 T202A probably damaging Het
Utp18 A T 11: 93,870,537 D348E possibly damaging Het
Vmn1r42 T G 6: 89,844,616 I324L probably benign Het
Wnt8a A T 18: 34,545,603 R157* probably null Het
Ypel1 A G 16: 17,084,608 probably null Het
Zfp235 A G 7: 24,137,121 K31E probably damaging Het
Zhx2 G C 15: 57,822,693 W486S probably damaging Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Z1177:AU040320 UTSW 4 126842633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACATAAAAGAGCCGTGTTTCTC -3'
(R):5'- CCCAACACGGTACACTTTGC -3'

Sequencing Primer
(F):5'- GAGCCGTGTTTCTCATTAATTTAAGC -3'
(R):5'- GCTACAATTGCTATGCTGGAC -3'
Posted On2016-06-06