Incidental Mutation 'R5085:Olfr1352'
ID387382
Institutional Source Beutler Lab
Gene Symbol Olfr1352
Ensembl Gene ENSMUSG00000046493
Gene Nameolfactory receptor 1352
SynonymsMOR139-1, GA_x6K02T2QGN0-2828447-2827518
MMRRC Submission 042674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5085 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78981050-78987903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78984094 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 101 (M101I)
Ref Sequence ENSEMBL: ENSMUSP00000054355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058991] [ENSMUST00000203973]
Predicted Effect probably benign
Transcript: ENSMUST00000058991
AA Change: M101I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054355
Gene: ENSMUSG00000046493
AA Change: M101I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.1e-6 PFAM
Pfam:7tm_1 41 290 4.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203973
AA Change: M68I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144895
Gene: ENSMUSG00000046493
AA Change: M68I

DomainStartEndE-ValueType
Pfam:7tm_4 1 122 6.1e-25 PFAM
Pfam:7TM_GPCR_Srx 1 123 7.5e-5 PFAM
Pfam:7TM_GPCR_Srsx 2 123 4.5e-8 PFAM
Pfam:7tm_1 8 123 2.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219714
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,678,180 S182G probably damaging Het
4930562C15Rik A T 16: 4,835,973 K129* probably null Het
Adamts6 A T 13: 104,307,243 D162V probably damaging Het
Alms1 C A 6: 85,620,732 P1316T possibly damaging Het
AU040320 A T 4: 126,828,871 N394I possibly damaging Het
Cacng8 T C 7: 3,415,580 L416P possibly damaging Het
Ccdc136 T A 6: 29,419,314 N944K probably damaging Het
Clcn1 C T 6: 42,313,880 T896I probably benign Het
Col16a1 A T 4: 130,054,171 Y228F probably damaging Het
Cyfip1 A G 7: 55,898,335 D561G probably benign Het
Ddr1 T A 17: 35,682,775 probably null Het
Dedd2 A T 7: 25,218,986 L48Q probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dph3b-ps A G 13: 106,547,050 noncoding transcript Het
Dppa3 T C 6: 122,629,932 F127S probably damaging Het
Dpy19l4 C T 4: 11,265,943 probably null Het
Flrt3 T C 2: 140,660,257 T484A probably damaging Het
Gldc T C 19: 30,151,536 E179G probably damaging Het
Gm14403 A G 2: 177,508,489 E76G probably benign Het
Gm6421 G A 13: 117,358,433 noncoding transcript Het
Grk5 T C 19: 61,076,684 V262A probably damaging Het
Grp A G 18: 65,880,159 Q132R probably benign Het
Hap1 A G 11: 100,355,711 F123L probably damaging Het
Hrc A G 7: 45,337,021 D532G probably damaging Het
Igsf9b C A 9: 27,317,437 F164L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl1 C T 11: 104,424,342 R290Q probably damaging Het
Kifc2 T A 15: 76,661,296 L81Q probably damaging Het
Klrc3 T C 6: 129,639,575 R160G probably damaging Het
Mal A G 2: 127,640,273 M70T probably benign Het
Mep1a T G 17: 43,478,144 R580S probably damaging Het
Methig1 A T 15: 100,353,249 I14F probably damaging Het
Mrvi1 G T 7: 110,871,493 L672I probably damaging Het
Mtf1 T C 4: 124,821,308 L242P probably damaging Het
Nfkb1 C A 3: 135,603,807 A509S probably benign Het
Olfr1056 A T 2: 86,355,974 M136K probably damaging Het
Olfr133 G A 17: 38,149,112 D175N probably damaging Het
Olfr206 A T 16: 59,345,086 I205K probably damaging Het
Olfr753-ps1 C G 17: 37,169,967 S227T probably benign Het
Pabpc2 A T 18: 39,774,582 N300I probably damaging Het
Peg10 C T 6: 4,755,864 probably benign Het
Ppp1r3a T A 6: 14,719,604 D437V probably damaging Het
Prickle1 A G 15: 93,500,902 S682P probably damaging Het
Prkab2 T C 3: 97,672,992 probably benign Het
Pus3 T A 9: 35,565,636 L243Q possibly damaging Het
Rgs19 G A 2: 181,689,543 T99M possibly damaging Het
Ripk2 A G 4: 16,127,663 S360P possibly damaging Het
Rock1 A G 18: 10,140,210 I127T probably damaging Het
Serpinb10 T G 1: 107,542,217 M143R probably damaging Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Skint6 T A 4: 113,236,268 Q226L probably damaging Het
Slc6a19 T C 13: 73,691,753 M137V probably benign Het
Supv3l1 A T 10: 62,435,512 N415K probably benign Het
Tcrg-V7 A T 13: 19,178,428 K96* probably null Het
Tekt4 A G 17: 25,473,775 R192G probably damaging Het
Tshz1 T C 18: 84,013,928 N785S probably benign Het
Usb1 A G 8: 95,344,051 T202A probably damaging Het
Utp18 A T 11: 93,870,537 D348E possibly damaging Het
Vmn1r42 T G 6: 89,844,616 I324L probably benign Het
Wnt8a A T 18: 34,545,603 R157* probably null Het
Ypel1 A G 16: 17,084,608 probably null Het
Zfp235 A G 7: 24,137,121 K31E probably damaging Het
Zhx2 G C 15: 57,822,693 W486S probably damaging Het
Other mutations in Olfr1352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Olfr1352 APN 10 78983862 missense probably damaging 0.96
IGL01865:Olfr1352 APN 10 78984678 missense possibly damaging 0.94
R0196:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R0362:Olfr1352 UTSW 10 78984386 missense probably benign 0.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R2982:Olfr1352 UTSW 10 78984440 missense probably damaging 1.00
R4724:Olfr1352 UTSW 10 78984522 missense probably damaging 1.00
R5000:Olfr1352 UTSW 10 78984680 missense probably benign 0.00
R5145:Olfr1352 UTSW 10 78984309 missense probably benign 0.35
R5455:Olfr1352 UTSW 10 78984537 missense possibly damaging 0.59
R5777:Olfr1352 UTSW 10 78984678 missense possibly damaging 0.78
R5822:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R6283:Olfr1352 UTSW 10 78984279 missense probably benign 0.01
R7242:Olfr1352 UTSW 10 78984497 nonsense probably null
R7504:Olfr1352 UTSW 10 78984660 missense possibly damaging 0.78
R8198:Olfr1352 UTSW 10 78984609 missense probably benign 0.03
R8268:Olfr1352 UTSW 10 78983997 missense probably damaging 0.98
R8684:Olfr1352 UTSW 10 78984378 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTGTAGTTGGAAACTTGCTC -3'
(R):5'- CCAAGTCTGTGCAGAAGGAC -3'

Sequencing Primer
(F):5'- GTTGGAAACTTGCTCATTATTCTCAC -3'
(R):5'- GCACCATCATGCTTTGTAACAAGG -3'
Posted On2016-06-06