Incidental Mutation 'R5085:Kansl1'
ID387386
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
MMRRC Submission 042674-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5085 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104424342 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 290 (R290Q)
Ref Sequence ENSEMBL: ENSMUSP00000102590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977] [ENSMUST00000134266]
Predicted Effect probably damaging
Transcript: ENSMUST00000018556
AA Change: R290Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: R290Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106971
AA Change: R290Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: R290Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106972
AA Change: R290Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: R290Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106977
AA Change: R290Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: R290Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134266
SMART Domains Protein: ENSMUSP00000116367
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195891
Meta Mutation Damage Score 0.2297 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,678,180 S182G probably damaging Het
4930562C15Rik A T 16: 4,835,973 K129* probably null Het
Adamts6 A T 13: 104,307,243 D162V probably damaging Het
Alms1 C A 6: 85,620,732 P1316T possibly damaging Het
AU040320 A T 4: 126,828,871 N394I possibly damaging Het
Cacng8 T C 7: 3,415,580 L416P possibly damaging Het
Ccdc136 T A 6: 29,419,314 N944K probably damaging Het
Clcn1 C T 6: 42,313,880 T896I probably benign Het
Col16a1 A T 4: 130,054,171 Y228F probably damaging Het
Cyfip1 A G 7: 55,898,335 D561G probably benign Het
Ddr1 T A 17: 35,682,775 probably null Het
Dedd2 A T 7: 25,218,986 L48Q probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dph3b-ps A G 13: 106,547,050 noncoding transcript Het
Dppa3 T C 6: 122,629,932 F127S probably damaging Het
Dpy19l4 C T 4: 11,265,943 probably null Het
Flrt3 T C 2: 140,660,257 T484A probably damaging Het
Gldc T C 19: 30,151,536 E179G probably damaging Het
Gm14403 A G 2: 177,508,489 E76G probably benign Het
Gm6421 G A 13: 117,358,433 noncoding transcript Het
Grk5 T C 19: 61,076,684 V262A probably damaging Het
Grp A G 18: 65,880,159 Q132R probably benign Het
Hap1 A G 11: 100,355,711 F123L probably damaging Het
Hrc A G 7: 45,337,021 D532G probably damaging Het
Igsf9b C A 9: 27,317,437 F164L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kifc2 T A 15: 76,661,296 L81Q probably damaging Het
Klrc3 T C 6: 129,639,575 R160G probably damaging Het
Mal A G 2: 127,640,273 M70T probably benign Het
Mep1a T G 17: 43,478,144 R580S probably damaging Het
Methig1 A T 15: 100,353,249 I14F probably damaging Het
Mrvi1 G T 7: 110,871,493 L672I probably damaging Het
Mtf1 T C 4: 124,821,308 L242P probably damaging Het
Nfkb1 C A 3: 135,603,807 A509S probably benign Het
Olfr1056 A T 2: 86,355,974 M136K probably damaging Het
Olfr133 G A 17: 38,149,112 D175N probably damaging Het
Olfr1352 G T 10: 78,984,094 M101I probably benign Het
Olfr206 A T 16: 59,345,086 I205K probably damaging Het
Olfr753-ps1 C G 17: 37,169,967 S227T probably benign Het
Pabpc2 A T 18: 39,774,582 N300I probably damaging Het
Peg10 C T 6: 4,755,864 probably benign Het
Ppp1r3a T A 6: 14,719,604 D437V probably damaging Het
Prickle1 A G 15: 93,500,902 S682P probably damaging Het
Prkab2 T C 3: 97,672,992 probably benign Het
Pus3 T A 9: 35,565,636 L243Q possibly damaging Het
Rgs19 G A 2: 181,689,543 T99M possibly damaging Het
Ripk2 A G 4: 16,127,663 S360P possibly damaging Het
Rock1 A G 18: 10,140,210 I127T probably damaging Het
Serpinb10 T G 1: 107,542,217 M143R probably damaging Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Skint6 T A 4: 113,236,268 Q226L probably damaging Het
Slc6a19 T C 13: 73,691,753 M137V probably benign Het
Supv3l1 A T 10: 62,435,512 N415K probably benign Het
Tcrg-V7 A T 13: 19,178,428 K96* probably null Het
Tekt4 A G 17: 25,473,775 R192G probably damaging Het
Tshz1 T C 18: 84,013,928 N785S probably benign Het
Usb1 A G 8: 95,344,051 T202A probably damaging Het
Utp18 A T 11: 93,870,537 D348E possibly damaging Het
Vmn1r42 T G 6: 89,844,616 I324L probably benign Het
Wnt8a A T 18: 34,545,603 R157* probably null Het
Ypel1 A G 16: 17,084,608 probably null Het
Zfp235 A G 7: 24,137,121 K31E probably damaging Het
Zhx2 G C 15: 57,822,693 W486S probably damaging Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7963:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7971:Kansl1 UTSW 11 104342422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTCCCTCTGAAGTGGCAG -3'
(R):5'- GTTAATTCCATGGACCAGCCGG -3'

Sequencing Primer
(F):5'- GCAGCTTTTCTCAAGGCAG -3'
(R):5'- CAGCCGGCACTTCAAGGAAG -3'
Posted On2016-06-06