Incidental Mutation 'R5086:Inpp5d'
ID387413
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87705964 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 441 (H441R)
Ref Sequence ENSEMBL: ENSMUSP00000132384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: H703R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: H703R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072999
AA Change: H703R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: H703R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163548
Predicted Effect probably damaging
Transcript: ENSMUST00000167032
AA Change: H441R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: H441R

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: H704R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: H704R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: H704R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: H704R

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170300
AA Change: H441R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: H441R

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Meta Mutation Damage Score 0.9565 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAAGTTCAGGCACCTTTG -3'
(R):5'- GTGATGTGGCCTGAACATGAAG -3'

Sequencing Primer
(F):5'- ACCTTTGCTTCTTGGACTCAGGG -3'
(R):5'- TGTGGCCTGAACATGAAGAGATC -3'
Posted On2016-06-06