Incidental Mutation 'R5086:Cdh26'
ID387419
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Namecadherin-like 26
SynonymsLOC381409
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location178430531-178487366 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 178441417 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 26 (R26*)
Ref Sequence ENSEMBL: ENSMUSP00000104540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]
Predicted Effect probably null
Transcript: ENSMUST00000042092
AA Change: R26*
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155
AA Change: R26*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108912
AA Change: R26*
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155
AA Change: R26*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178481624 missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178457447 missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178449962 missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178468174 missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178466828 critical splice donor site probably null
R0610:Cdh26 UTSW 2 178449898 missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178486931 missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178449891 missense probably damaging 1.00
R2483:Cdh26 UTSW 2 178466589 missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178470001 splice site probably benign
R4617:Cdh26 UTSW 2 178460642 intron probably benign
R4914:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4915:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4917:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4918:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R5573:Cdh26 UTSW 2 178466689 missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178460126 nonsense probably null
R5941:Cdh26 UTSW 2 178481650 nonsense probably null
R6284:Cdh26 UTSW 2 178449884 missense probably damaging 1.00
R6341:Cdh26 UTSW 2 178471573 splice site probably null
R6496:Cdh26 UTSW 2 178449861 missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178486762 missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178470042 missense probably benign 0.02
R7694:Cdh26 UTSW 2 178460103 missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178470035 missense probably damaging 0.98
RF002:Cdh26 UTSW 2 178466631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTCTGATGATAGCTC -3'
(R):5'- ATCAGGCAGGTACCTAACAAGG -3'

Sequencing Primer
(F):5'- CTCTGATGATAGCTCTGAGTGAAAAC -3'
(R):5'- GGATACTGTATGATCCTGGCTTC -3'
Posted On2016-06-06