Incidental Mutation 'R5086:Il21r'
ID387442
Institutional Source Beutler Lab
Gene Symbol Il21r
Ensembl Gene ENSMUSG00000030745
Gene Nameinterleukin 21 receptor
SynonymsNILR
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125603429-125633570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125632855 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 485 (D485G)
Ref Sequence ENSEMBL: ENSMUSP00000033000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]
Predicted Effect probably damaging
Transcript: ENSMUST00000033000
AA Change: D485G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: D485G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 120 209 3.4e0 SMART
low complexity region 239 250 N/A INTRINSIC
low complexity region 307 312 N/A INTRINSIC
low complexity region 424 450 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206103
Predicted Effect probably benign
Transcript: ENSMUST00000206234
Meta Mutation Damage Score 0.1580 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Il21r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Il21r APN 7 125632525 missense probably damaging 1.00
bellflower UTSW 7 125628043 critical splice acceptor site probably null
R0409:Il21r UTSW 7 125629840 intron probably benign
R0573:Il21r UTSW 7 125625285 missense probably benign 0.06
R0635:Il21r UTSW 7 125632506 missense probably damaging 1.00
R1933:Il21r UTSW 7 125628981 missense possibly damaging 0.92
R1969:Il21r UTSW 7 125628972 missense probably damaging 0.99
R3716:Il21r UTSW 7 125632269 missense probably damaging 0.96
R3968:Il21r UTSW 7 125628043 critical splice acceptor site probably null
R4546:Il21r UTSW 7 125628899 missense probably damaging 1.00
R5566:Il21r UTSW 7 125625298 missense probably damaging 1.00
R5988:Il21r UTSW 7 125632288 missense probably damaging 0.99
R6234:Il21r UTSW 7 125632585 missense probably damaging 1.00
R6259:Il21r UTSW 7 125630719 missense possibly damaging 0.65
R6896:Il21r UTSW 7 125626956 missense probably damaging 1.00
R7162:Il21r UTSW 7 125632311 missense probably benign 0.00
R7263:Il21r UTSW 7 125632905 missense probably benign 0.04
R7740:Il21r UTSW 7 125632555 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCTGGCCCTAATTCAGAGGATC -3'
(R):5'- GGCCTCTTCTCACTATAGCTGG -3'

Sequencing Primer
(F):5'- AGGATCTGCTCTTGGTCACAGAC -3'
(R):5'- AGCTGGTTATTATATGCTAGCTGCTC -3'
Posted On2016-06-06