Mutagenetix > Incidental Mutations

Incidental Mutation 'R5086:Il21r'

387442

Institutional Source

Beutler Lab

Gene Symbol

Il21r

Ensembl Gene

ENSMUSG00000030745

Gene Name

interleukin 21 receptor

Synonyms

NILR

MMRRC Submission

042675-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125603429-125633570 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125632855 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 485 (D485G)

Ref Sequence

ENSEMBL: ENSMUSP00000033000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033000
AA Change: D485G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: D485G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
FN3	120	209	3.4e0	SMART
low complexity region	239	250	N/A	INTRINSIC
low complexity region	307	312	N/A	INTRINSIC
low complexity region	424	450	N/A	INTRINSIC
low complexity region	466	481	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206103

Predicted Effect

probably benign
Transcript: ENSMUST00000206234

Meta Mutation Damage Score

0.1580

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adsl	T	A	15: 80,963,700	M278K	probably damaging	Het
Ago1	T	C	4: 126,453,604	I147V	probably benign	Het
Ank1	T	C	8: 23,088,618	L261P	probably damaging	Het
Ank2	T	C	3: 126,947,348		probably benign	Het
Ap1b1	T	C	11: 5,018,020	V177A	possibly damaging	Het
Arhgap21	A	G	2: 20,848,834	S1906P	probably benign	Het
Asb1	A	G	1: 91,554,811	Y214C	probably benign	Het
BC049715	C	T	6: 136,840,431	T223M	probably damaging	Het
C1ra	T	A	6: 124,519,729	C375S	probably damaging	Het
C530008M17Rik	A	G	5: 76,857,124	E444G	unknown	Het
Cdh26	C	T	2: 178,441,417	R26*	probably null	Het
Chordc1	A	G	9: 18,312,835	M304V	probably benign	Het
Cpne8	T	C	15: 90,648,568		probably benign	Het
Csf1	T	C	3: 107,748,710	E335G	possibly damaging	Het
Ctnnd2	C	T	15: 30,683,347	P498L	possibly damaging	Het
Cyp4f18	C	T	8: 72,002,432	R100H	probably benign	Het
Dnaaf2	G	A	12: 69,197,286	R334C	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dock10	A	G	1: 80,551,472	S1071P	possibly damaging	Het
Dtnb	T	C	12: 3,632,942	V7A	probably benign	Het
Eif1	T	C	11: 100,320,726	I62T	probably damaging	Het
Fbxo44	T	A	4: 148,156,212	T145S	probably benign	Het
G530012D18Rik	G	C	1: 85,577,220		probably benign	Het
Gabbr2	A	T	4: 46,724,342	M17K	probably damaging	Het
Gm1966	A	T	7: 106,598,027		noncoding transcript	Het
Gm5860	T	A	4: 82,065,936		noncoding transcript	Het
Gm7964	T	A	7: 83,757,352	F439Y	possibly damaging	Het
Gpbp1l1	C	A	4: 116,588,592	T297N	probably benign	Het
Greb1	C	T	12: 16,708,022		probably benign	Het
Hkdc1	T	C	10: 62,395,274		probably benign	Het
Ighv16-1	T	A	12: 114,068,890	L97F	probably benign	Het
Inpp5d	A	G	1: 87,705,964	H441R	probably damaging	Het
Iqgap2	G	T	13: 95,635,580	R1364S	probably benign	Het
Krtap20-2	G	T	16: 89,205,918	C2F	unknown	Het
Man2c1	T	A	9: 57,131,640	D111E	probably damaging	Het
Map1a	G	A	2: 121,304,504	E1696K	probably damaging	Het
Mdc1	T	A	17: 35,848,630	V634E	probably benign	Het
Mgam2-ps	A	G	6: 40,823,613		noncoding transcript	Het
Mllt3	T	A	4: 87,789,298	N68Y	probably damaging	Het
Mrps18a	T	A	17: 46,125,695	D143E	probably benign	Het
Myl12a	T	C	17: 70,994,616	D172G	possibly damaging	Het
Notch3	T	C	17: 32,143,334	N1439S	probably benign	Het
Npepps	T	C	11: 97,217,799	M764V	probably benign	Het
Olfr926	T	C	9: 38,877,791	L205P	probably damaging	Het
Paxbp1	A	T	16: 91,015,216		probably benign	Het
Pcdhb7	A	T	18: 37,343,109	T433S	possibly damaging	Het
Pcdhb8	A	T	18: 37,356,106	Y279F	probably damaging	Het
Pim3	T	C	15: 88,864,403	L235P	probably damaging	Het
Plekha4	C	T	7: 45,553,658	S685F	possibly damaging	Het
Plekhg1	C	A	10: 3,903,649	H167Q	probably damaging	Het
Plekhn1	G	C	4: 156,222,424	P503A	probably benign	Het
Sar1a	T	C	10: 61,691,346	L181P	probably damaging	Het
Sec22a	G	T	16: 35,347,742	S133*	probably null	Het
Sipa1l3	G	A	7: 29,348,575	S247F	probably damaging	Het
Slc31a1	T	C	4: 62,387,953	S103P	probably damaging	Het
Spag6	A	C	2: 18,742,877		probably benign	Het
Stab1	T	A	14: 31,143,624	D1769V	probably damaging	Het
Stab1	G	A	14: 31,159,304	L590F	probably damaging	Het
Syde2	CAGTT	CAGTTAGTT	3: 146,001,408		probably null	Het
Tbc1d2b	A	G	9: 90,227,457	L322P	probably benign	Het
Tdrp	T	C	8: 13,974,590	E18G	possibly damaging	Het
Tlr3	T	A	8: 45,402,825	N106I	probably damaging	Het
Tmem104	T	A	11: 115,201,401	I112N	probably damaging	Het
Tmem14c	C	T	13: 41,021,122	T69I	probably benign	Het
Tmprss11g	G	A	5: 86,496,518	P156S	possibly damaging	Het
Ttn	A	T	2: 76,870,603		probably benign	Het
Vmn1r45	A	T	6: 89,933,100	I296N	probably benign	Het
Vmn2r1	T	A	3: 64,089,997	V358D	probably benign	Het
Zc3h7b	T	C	15: 81,793,174	L892P	probably damaging	Het
Zfp366	A	G	13: 99,228,943	Q204R	probably benign	Het
Zfp598	C	A	17: 24,680,898		probably benign	Het

Other mutations in Il21r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Il21r	APN	7	125632525	missense	probably damaging	1.00
bellflower	UTSW	7	125628043	critical splice acceptor site	probably null
R0409:Il21r	UTSW	7	125629840	intron	probably benign
R0573:Il21r	UTSW	7	125625285	missense	probably benign	0.06
R0635:Il21r	UTSW	7	125632506	missense	probably damaging	1.00
R1933:Il21r	UTSW	7	125628981	missense	possibly damaging	0.92
R1969:Il21r	UTSW	7	125628972	missense	probably damaging	0.99
R3716:Il21r	UTSW	7	125632269	missense	probably damaging	0.96
R3968:Il21r	UTSW	7	125628043	critical splice acceptor site	probably null
R4546:Il21r	UTSW	7	125628899	missense	probably damaging	1.00
R5566:Il21r	UTSW	7	125625298	missense	probably damaging	1.00
R5988:Il21r	UTSW	7	125632288	missense	probably damaging	0.99
R6234:Il21r	UTSW	7	125632585	missense	probably damaging	1.00
R6259:Il21r	UTSW	7	125630719	missense	possibly damaging	0.65
R6896:Il21r	UTSW	7	125626956	missense	probably damaging	1.00
R7162:Il21r	UTSW	7	125632311	missense	probably benign	0.00
R7263:Il21r	UTSW	7	125632905	missense	probably benign	0.04
R7740:Il21r	UTSW	7	125632555	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GTCTGGCCCTAATTCAGAGGATC -3'
(R):5'- GGCCTCTTCTCACTATAGCTGG -3'

Sequencing Primer
(F):5'- AGGATCTGCTCTTGGTCACAGAC -3'
(R):5'- AGCTGGTTATTATATGCTAGCTGCTC -3'

Posted On

2016-06-06