Incidental Mutation 'R5086:Cyp4f18'
ID387446
Institutional Source Beutler Lab
Gene Symbol Cyp4f18
Ensembl Gene ENSMUSG00000003484
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms1810054N16Rik
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71988482-72009626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72002432 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 100 (R100H)
Ref Sequence ENSEMBL: ENSMUSP00000003574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003574]
Predicted Effect probably benign
Transcript: ENSMUST00000003574
AA Change: R100H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003574
Gene: ENSMUSG00000003484
AA Change: R100H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 516 2.7e-132 PFAM
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukotriene B4 metabolism but show no significant alterations in inflammatory cell infiltration or injury following renal ischemia-reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Cyp4f18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cyp4f18 APN 8 71989927 missense probably damaging 0.96
IGL01465:Cyp4f18 APN 8 72002444 missense probably benign
IGL01863:Cyp4f18 APN 8 71989926 missense possibly damaging 0.49
IGL02403:Cyp4f18 APN 8 71998228 missense probably damaging 0.97
IGL03244:Cyp4f18 APN 8 71988645 missense probably benign 0.12
R0226:Cyp4f18 UTSW 8 71989775 splice site probably benign
R0310:Cyp4f18 UTSW 8 72001012 splice site probably benign
R0486:Cyp4f18 UTSW 8 71996017 missense probably benign 0.02
R0506:Cyp4f18 UTSW 8 71996000 missense probably benign 0.00
R0547:Cyp4f18 UTSW 8 71996010 missense probably benign 0.00
R0689:Cyp4f18 UTSW 8 71995968 missense probably benign
R0721:Cyp4f18 UTSW 8 72001135 missense probably benign 0.02
R1534:Cyp4f18 UTSW 8 71992955 missense probably damaging 1.00
R2087:Cyp4f18 UTSW 8 72000988 missense probably benign
R2902:Cyp4f18 UTSW 8 72002411 missense probably damaging 0.96
R3149:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3150:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3177:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3277:Cyp4f18 UTSW 8 71993200 missense possibly damaging 0.69
R3906:Cyp4f18 UTSW 8 72001082 splice site probably benign
R3916:Cyp4f18 UTSW 8 71996037 missense probably benign 0.03
R3953:Cyp4f18 UTSW 8 72000957 missense probably damaging 1.00
R4815:Cyp4f18 UTSW 8 71995995 missense possibly damaging 0.52
R4915:Cyp4f18 UTSW 8 72009054 missense probably damaging 1.00
R5113:Cyp4f18 UTSW 8 71989058 critical splice donor site probably null
R5202:Cyp4f18 UTSW 8 72009096 missense probably benign 0.03
R5761:Cyp4f18 UTSW 8 71996131 missense probably damaging 0.99
R6187:Cyp4f18 UTSW 8 71993186 missense probably damaging 0.98
R6664:Cyp4f18 UTSW 8 71989915 missense probably benign 0.21
R6944:Cyp4f18 UTSW 8 71989894 missense probably benign 0.03
R6978:Cyp4f18 UTSW 8 72002496 missense probably benign
R7288:Cyp4f18 UTSW 8 71993173 missense probably damaging 1.00
R7326:Cyp4f18 UTSW 8 71988654 missense probably benign 0.14
R7432:Cyp4f18 UTSW 8 71996062 missense probably benign 0.00
R7871:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R7954:Cyp4f18 UTSW 8 71988643 missense possibly damaging 0.69
R8063:Cyp4f18 UTSW 8 71998231 missense probably damaging 1.00
Z1177:Cyp4f18 UTSW 8 71998283 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTCCACACACCAGAAAGATGG -3'
(R):5'- GCTCAGTGCTGTGGATGAATTC -3'

Sequencing Primer
(F):5'- TGCTCTAAACAGGTGCCACATG -3'
(R):5'- GATGAATTCCTGGAACTCCTGTGAC -3'
Posted On2016-06-06