Incidental Mutation 'R5086:Dtnb'
ID387458
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5086 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3632942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173736] [ENSMUST00000174109] [ENSMUST00000174290] [ENSMUST00000174479] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect probably benign
Transcript: ENSMUST00000077930
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101637
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164578
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164607
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168806
Predicted Effect probably benign
Transcript: ENSMUST00000172598
AA Change: V7A

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134124
Gene: ENSMUSG00000071454
AA Change: V7A

DomainStartEndE-ValueType
Pfam:EF-hand_3 1 46 7.7e-15 PFAM
ZnF_ZZ 51 96 3.29e-15 SMART
low complexity region 217 230 N/A INTRINSIC
coiled coil region 242 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173199
AA Change: V194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173240
AA Change: V194A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173483
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173524
Predicted Effect probably benign
Transcript: ENSMUST00000173736
AA Change: V194A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174109
SMART Domains Protein: ENSMUSP00000134151
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 132 1.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174290
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174479
AA Change: V194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133702
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 3.9e-41 PFAM
Pfam:EF-hand_3 144 232 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174547
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174639
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174663
AA Change: V194A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454
AA Change: V194A

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0449:Dtnb UTSW 12 3591971 nonsense probably null
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R2074:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R4816:Dtnb UTSW 12 3749505 missense probably damaging 0.99
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6724:Dtnb UTSW 12 3686817 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7078:Dtnb UTSW 12 3748480 missense possibly damaging 0.80
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
R7408:Dtnb UTSW 12 3644272 intron probably null
R7538:Dtnb UTSW 12 3773611 missense possibly damaging 0.80
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGGTATAGAAATAACAGAGCCATT -3'
(R):5'- AACATGCATCACTCACAACAATTTT -3'

Sequencing Primer
(F):5'- TCCCAGATGTCAGATTCC -3'
(R):5'- ATAGCCCAGCTAAGTCTGGTCATG -3'
Posted On2016-06-06