Incidental Mutation 'R5087:Moxd2'
ID387504
Institutional Source Beutler Lab
Gene Symbol Moxd2
Ensembl Gene ENSMUSG00000029885
Gene Namemonooxygenase, DBH-like 2
SynonymsDbhl1
MMRRC Submission 042676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5087 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40878794-40887494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40879336 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 534 (L534W)
Ref Sequence ENSEMBL: ENSMUSP00000031937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031937]
Predicted Effect probably damaging
Transcript: ENSMUST00000031937
AA Change: L534W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031937
Gene: ENSMUSG00000029885
AA Change: L534W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
DoH 66 156 1.43e-12 SMART
Pfam:Cu2_monooxygen 192 316 8.3e-39 PFAM
Pfam:Cu2_monoox_C 336 493 1.8e-37 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,266,221 V361M probably damaging Het
Adhfe1 A G 1: 9,561,626 probably benign Het
Anln T C 9: 22,375,044 T322A possibly damaging Het
Best3 A T 10: 117,009,002 Y354F probably benign Het
Cd44 C T 2: 102,831,354 V509I possibly damaging Het
Cdk5rap1 T C 2: 154,342,395 N529S probably damaging Het
Cnst A G 1: 179,622,813 D614G possibly damaging Het
Cpq T C 15: 33,212,862 I9T probably benign Het
Cyp2j6 T C 4: 96,531,699 H265R probably damaging Het
Dctn1 T A 6: 83,191,639 M458K probably damaging Het
Disc1 A C 8: 125,132,160 I454L probably benign Het
Dnaja4 A G 9: 54,699,739 E4G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eipr1 C A 12: 28,828,856 N136K probably benign Het
Fut11 A G 14: 20,696,161 N357S probably damaging Het
Gbp2b C T 3: 142,598,254 P37S probably damaging Het
Ghr T G 15: 3,320,140 K519Q probably damaging Het
Gipr C A 7: 19,159,764 C328F probably damaging Het
Gm27013 A T 6: 130,677,670 N276K probably damaging Het
Gm8909 C A 17: 36,165,416 G347* probably null Het
Got2 C A 8: 95,872,323 K150N probably benign Het
Gucy2c A G 6: 136,767,035 S189P possibly damaging Het
Hells T C 19: 38,943,745 V153A probably benign Het
Ighd G A 12: 113,414,427 probably benign Het
Itga4 A C 2: 79,315,629 D725A possibly damaging Het
Itgbl1 T A 14: 123,966,739 L414Q possibly damaging Het
Kat2b-ps A G 5: 93,391,726 noncoding transcript Het
Lrrc1 A T 9: 77,457,458 S192T probably benign Het
Mc2r A T 18: 68,408,203 N6K probably benign Het
Myh4 A T 11: 67,255,409 D1431V probably damaging Het
Naa15 T A 3: 51,457,285 probably null Het
Naa16 G A 14: 79,377,415 T215I possibly damaging Het
Ntng1 A T 3: 110,135,329 Y60* probably null Het
Olfr117 A T 17: 37,659,721 V204E probably damaging Het
Olfr389 T C 11: 73,777,258 Y23C possibly damaging Het
Pccb T C 9: 100,985,243 probably benign Het
Pcnx C A 12: 81,994,939 P2115Q probably damaging Het
Pfkfb3 G A 2: 11,484,014 T313I probably damaging Het
Pld1 A G 3: 28,124,582 N875S probably damaging Het
Ptpn20 A T 14: 33,614,441 D79V possibly damaging Het
Rabgap1l C A 1: 160,722,239 V266L probably damaging Het
Reep6 A G 10: 80,335,175 D295G probably damaging Het
Sass6 T C 3: 116,610,298 L195P probably damaging Het
Slc25a27 A G 17: 43,666,930 S25P probably damaging Het
Smok2b T A 17: 13,235,124 M57K probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sspo T C 6: 48,488,471 V71A possibly damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Stard9 T A 2: 120,697,019 Y1252* probably null Het
Syde2 T A 3: 146,007,126 D1006E probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tmc5 G A 7: 118,645,386 A496T possibly damaging Het
Ttn A G 2: 76,736,360 V28063A probably damaging Het
Usp25 A C 16: 77,077,119 I528L probably benign Het
Vmn1r58 C T 7: 5,410,667 S188N probably benign Het
Wfikkn2 A T 11: 94,238,347 C323S probably damaging Het
Zfy1 A C Y: 732,964 S290A unknown Het
Other mutations in Moxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Moxd2 APN 6 40884179 splice site probably benign
IGL02113:Moxd2 APN 6 40885404 missense probably benign 0.06
IGL02223:Moxd2 APN 6 40885033 missense probably damaging 1.00
IGL03204:Moxd2 APN 6 40887305 missense probably benign 0.04
IGL03385:Moxd2 APN 6 40879018 missense probably damaging 1.00
R0084:Moxd2 UTSW 6 40879408 missense probably null 0.01
R1213:Moxd2 UTSW 6 40891897 unclassified probably benign
R1326:Moxd2 UTSW 6 40880354 missense probably benign 0.00
R1652:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
R1940:Moxd2 UTSW 6 40883532 missense probably damaging 1.00
R2040:Moxd2 UTSW 6 40884953 splice site probably null
R2088:Moxd2 UTSW 6 40884967 missense probably damaging 1.00
R3018:Moxd2 UTSW 6 40878886 missense probably benign 0.01
R3962:Moxd2 UTSW 6 40885397 missense probably benign
R4248:Moxd2 UTSW 6 40878999 missense probably damaging 1.00
R4438:Moxd2 UTSW 6 40884062 missense probably damaging 1.00
R4715:Moxd2 UTSW 6 40887247 missense probably damaging 1.00
R4732:Moxd2 UTSW 6 40878859 missense probably benign
R4733:Moxd2 UTSW 6 40878859 missense probably benign
R4760:Moxd2 UTSW 6 40891603 missense probably benign 0.06
R4851:Moxd2 UTSW 6 40878822 missense probably damaging 1.00
R5187:Moxd2 UTSW 6 40879337 missense probably benign 0.18
R5339:Moxd2 UTSW 6 40885420 missense probably damaging 1.00
R5452:Moxd2 UTSW 6 40882114 splice site probably null
R5860:Moxd2 UTSW 6 40880407 missense probably damaging 1.00
R5973:Moxd2 UTSW 6 40878810 missense probably damaging 0.96
R6015:Moxd2 UTSW 6 40883754 missense probably damaging 1.00
R6316:Moxd2 UTSW 6 40883547 missense probably damaging 1.00
R7561:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
X0052:Moxd2 UTSW 6 40882528 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTACAAGCTAAACTGGGAG -3'
(R):5'- GAAGGTGTTCTTTCACAATTTCGTC -3'

Sequencing Primer
(F):5'- CTTACAAGCTAAACTGGGAGACTGC -3'
(R):5'- TCGTCTGAGCTATAAGTCAACATC -3'
Posted On2016-06-06