Incidental Mutation 'R5087:Dctn1'
ID387506
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission 042676-MU
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5087 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83191639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 458 (M458K)
Ref Sequence ENSEMBL: ENSMUSP00000109540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919] [ENSMUST00000130212] [ENSMUST00000141680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077407
AA Change: M555K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: M555K

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113907
AA Change: M458K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: M458K

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113913
AA Change: M575K
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: M575K

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113918
AA Change: M592K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: M592K

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113919
AA Change: M592K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: M592K

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127824
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130917
Predicted Effect probably benign
Transcript: ENSMUST00000141680
SMART Domains Protein: ENSMUSP00000121538
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154420
Meta Mutation Damage Score 0.2929 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,266,221 V361M probably damaging Het
Adhfe1 A G 1: 9,561,626 probably benign Het
Anln T C 9: 22,375,044 T322A possibly damaging Het
Best3 A T 10: 117,009,002 Y354F probably benign Het
Cd44 C T 2: 102,831,354 V509I possibly damaging Het
Cdk5rap1 T C 2: 154,342,395 N529S probably damaging Het
Cnst A G 1: 179,622,813 D614G possibly damaging Het
Cpq T C 15: 33,212,862 I9T probably benign Het
Cyp2j6 T C 4: 96,531,699 H265R probably damaging Het
Disc1 A C 8: 125,132,160 I454L probably benign Het
Dnaja4 A G 9: 54,699,739 E4G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eipr1 C A 12: 28,828,856 N136K probably benign Het
Fut11 A G 14: 20,696,161 N357S probably damaging Het
Gbp2b C T 3: 142,598,254 P37S probably damaging Het
Ghr T G 15: 3,320,140 K519Q probably damaging Het
Gipr C A 7: 19,159,764 C328F probably damaging Het
Gm27013 A T 6: 130,677,670 N276K probably damaging Het
Gm8909 C A 17: 36,165,416 G347* probably null Het
Got2 C A 8: 95,872,323 K150N probably benign Het
Gucy2c A G 6: 136,767,035 S189P possibly damaging Het
Hells T C 19: 38,943,745 V153A probably benign Het
Ighd G A 12: 113,414,427 probably benign Het
Itga4 A C 2: 79,315,629 D725A possibly damaging Het
Itgbl1 T A 14: 123,966,739 L414Q possibly damaging Het
Kat2b-ps A G 5: 93,391,726 noncoding transcript Het
Lrrc1 A T 9: 77,457,458 S192T probably benign Het
Mc2r A T 18: 68,408,203 N6K probably benign Het
Moxd2 A C 6: 40,879,336 L534W probably damaging Het
Myh4 A T 11: 67,255,409 D1431V probably damaging Het
Naa15 T A 3: 51,457,285 probably null Het
Naa16 G A 14: 79,377,415 T215I possibly damaging Het
Ntng1 A T 3: 110,135,329 Y60* probably null Het
Olfr117 A T 17: 37,659,721 V204E probably damaging Het
Olfr389 T C 11: 73,777,258 Y23C possibly damaging Het
Pccb T C 9: 100,985,243 probably benign Het
Pcnx C A 12: 81,994,939 P2115Q probably damaging Het
Pfkfb3 G A 2: 11,484,014 T313I probably damaging Het
Pld1 A G 3: 28,124,582 N875S probably damaging Het
Ptpn20 A T 14: 33,614,441 D79V possibly damaging Het
Rabgap1l C A 1: 160,722,239 V266L probably damaging Het
Reep6 A G 10: 80,335,175 D295G probably damaging Het
Sass6 T C 3: 116,610,298 L195P probably damaging Het
Slc25a27 A G 17: 43,666,930 S25P probably damaging Het
Smok2b T A 17: 13,235,124 M57K probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sspo T C 6: 48,488,471 V71A possibly damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Stard9 T A 2: 120,697,019 Y1252* probably null Het
Syde2 T A 3: 146,007,126 D1006E probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tmc5 G A 7: 118,645,386 A496T possibly damaging Het
Ttn A G 2: 76,736,360 V28063A probably damaging Het
Usp25 A C 16: 77,077,119 I528L probably benign Het
Vmn1r58 C T 7: 5,410,667 S188N probably benign Het
Wfikkn2 A T 11: 94,238,347 C323S probably damaging Het
Zfy1 A C Y: 732,964 S290A unknown Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7052:Dctn1 UTSW 6 83195280 intron probably null
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83195069 nonsense probably null
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAATTGTGGAAGAATCCTGAC -3'
(R):5'- TGTTCACTGAGCCCCTACAG -3'

Sequencing Primer
(F):5'- GAAGAATCCTGACCTGGGCTTAC -3'
(R):5'- GAGTACCTAGGCTACCTTGTAAACTG -3'
Posted On2016-06-06