Incidental Mutation 'R5087:Got2'
ID 387514
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Name glutamatic-oxaloacetic transaminase 2, mitochondrial
Synonyms FABP-pm, Got-2, plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, mAspAT
MMRRC Submission 042676-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock # R5087 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 95864134-95888547 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 95872323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 150 (K150N)
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
AlphaFold P05202
PDB Structure Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034097
AA Change: K150N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672
AA Change: K150N

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212190
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,266,221 V361M probably damaging Het
Adhfe1 A G 1: 9,561,626 probably benign Het
Anln T C 9: 22,375,044 T322A possibly damaging Het
Best3 A T 10: 117,009,002 Y354F probably benign Het
Cd44 C T 2: 102,831,354 V509I possibly damaging Het
Cdk5rap1 T C 2: 154,342,395 N529S probably damaging Het
Cnst A G 1: 179,622,813 D614G possibly damaging Het
Cpq T C 15: 33,212,862 I9T probably benign Het
Cyp2j6 T C 4: 96,531,699 H265R probably damaging Het
Dctn1 T A 6: 83,191,639 M458K probably damaging Het
Disc1 A C 8: 125,132,160 I454L probably benign Het
Dnaja4 A G 9: 54,699,739 E4G probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eipr1 C A 12: 28,828,856 N136K probably benign Het
Fut11 A G 14: 20,696,161 N357S probably damaging Het
Gbp2b C T 3: 142,598,254 P37S probably damaging Het
Ghr T G 15: 3,320,140 K519Q probably damaging Het
Gipr C A 7: 19,159,764 C328F probably damaging Het
Gm27013 A T 6: 130,677,670 N276K probably damaging Het
Gm8909 C A 17: 36,165,416 G347* probably null Het
Gucy2c A G 6: 136,767,035 S189P possibly damaging Het
Hells T C 19: 38,943,745 V153A probably benign Het
Ighd G A 12: 113,414,427 probably benign Het
Itga4 A C 2: 79,315,629 D725A possibly damaging Het
Itgbl1 T A 14: 123,966,739 L414Q possibly damaging Het
Kat2b-ps A G 5: 93,391,726 noncoding transcript Het
Lrrc1 A T 9: 77,457,458 S192T probably benign Het
Mc2r A T 18: 68,408,203 N6K probably benign Het
Moxd2 A C 6: 40,879,336 L534W probably damaging Het
Myh4 A T 11: 67,255,409 D1431V probably damaging Het
Naa15 T A 3: 51,457,285 probably null Het
Naa16 G A 14: 79,377,415 T215I possibly damaging Het
Ntng1 A T 3: 110,135,329 Y60* probably null Het
Olfr117 A T 17: 37,659,721 V204E probably damaging Het
Olfr389 T C 11: 73,777,258 Y23C possibly damaging Het
Pccb T C 9: 100,985,243 probably benign Het
Pcnx C A 12: 81,994,939 P2115Q probably damaging Het
Pfkfb3 G A 2: 11,484,014 T313I probably damaging Het
Pld1 A G 3: 28,124,582 N875S probably damaging Het
Ptpn20 A T 14: 33,614,441 D79V possibly damaging Het
Rabgap1l C A 1: 160,722,239 V266L probably damaging Het
Reep6 A G 10: 80,335,175 D295G probably damaging Het
Sass6 T C 3: 116,610,298 L195P probably damaging Het
Slc25a27 A G 17: 43,666,930 S25P probably damaging Het
Smok2b T A 17: 13,235,124 M57K probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sspo T C 6: 48,488,471 V71A possibly damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Stard9 T A 2: 120,697,019 Y1252* probably null Het
Syde2 T A 3: 146,007,126 D1006E probably damaging Het
Syde2 CAGTT CAGTTAGTT 3: 146,001,408 probably null Het
Tmc5 G A 7: 118,645,386 A496T possibly damaging Het
Ttn A G 2: 76,736,360 V28063A probably damaging Het
Usp25 A C 16: 77,077,119 I528L probably benign Het
Vmn1r58 C T 7: 5,410,667 S188N probably benign Het
Wfikkn2 A T 11: 94,238,347 C323S probably damaging Het
Zfy1 A C Y: 732,964 S290A unknown Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 95872201 missense probably benign 0.06
Toothpick UTSW 8 95872268 missense probably benign 0.20
R0189:Got2 UTSW 8 95888253 missense probably benign 0.11
R0254:Got2 UTSW 8 95869538 missense probably benign 0.03
R1450:Got2 UTSW 8 95871986 missense probably benign 0.00
R1552:Got2 UTSW 8 95869494 missense probably benign 0.22
R2495:Got2 UTSW 8 95888290 missense possibly damaging 0.81
R3946:Got2 UTSW 8 95888230 missense probably benign
R4021:Got2 UTSW 8 95877753 missense probably damaging 1.00
R4594:Got2 UTSW 8 95872186 missense probably benign 0.15
R5233:Got2 UTSW 8 95875849 missense probably benign 0.33
R6156:Got2 UTSW 8 95872268 missense probably benign 0.20
R6529:Got2 UTSW 8 95888385 start gained probably benign
R8481:Got2 UTSW 8 95888524 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAAGTCAGACAATGAAAGTGGC -3'
(R):5'- CTAGCCAGCAAATTCCCGTG -3'

Sequencing Primer
(F):5'- AGACACCAGAAGTCGGGCC -3'
(R):5'- GCCAGCAAATTCCCGTGTAAGG -3'
Posted On 2016-06-06