Incidental Mutation 'R5088:Stk4'
ID387555
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Nameserine/threonine kinase 4
SynonymsYsk3, sterile 20-like kinase 1, Kas-2, Mst1
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5088 (G1)
Quality Score175
Status Validated
Chromosome2
Chromosomal Location164070322-164155524 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 164083688 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 58 (K58*)
Ref Sequence ENSEMBL: ENSMUSP00000122440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353] [ENSMUST00000134078]
Predicted Effect probably null
Transcript: ENSMUST00000018353
AA Change: K59*
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: K59*

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134078
AA Change: K58*
SMART Domains Protein: ENSMUSP00000122440
Gene: ENSMUSG00000018209
AA Change: K58*

DomainStartEndE-ValueType
Pfam:Pkinase 29 113 7.2e-22 PFAM
Pfam:Pkinase_Tyr 29 113 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153319
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
R7698:Stk4 UTSW 2 164083743 missense probably damaging 1.00
R7726:Stk4 UTSW 2 164110226 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTGGCCATAGAAAACACACATG -3'
(R):5'- TTTTCAGAAAGAACATGCCCTGC -3'

Sequencing Primer
(F):5'- ATCGCATTCAGACTGCATGG -3'
(R):5'- GAAAGAACATGCCCTGCGGTTC -3'
Posted On2016-06-06