Incidental Mutation 'R5088:Hnf4g'
ID387556
Institutional Source Beutler Lab
Gene Symbol Hnf4g
Ensembl Gene ENSMUSG00000017688
Gene Namehepatocyte nuclear factor 4, gamma
SynonymsNR2A2
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location3508030-3658052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3657121 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 445 (A445V)
Ref Sequence ENSEMBL: ENSMUSP00000104031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108393] [ENSMUST00000108394]
Predicted Effect probably benign
Transcript: ENSMUST00000108393
AA Change: A401V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104030
Gene: ENSMUSG00000017688
AA Change: A401V

DomainStartEndE-ValueType
ZnF_C4 9 80 6.51e-35 SMART
low complexity region 118 125 N/A INTRINSIC
HOLI 141 299 7.29e-47 SMART
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108394
AA Change: A445V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104031
Gene: ENSMUSG00000017688
AA Change: A445V

DomainStartEndE-ValueType
ZnF_C4 63 134 6.51e-35 SMART
low complexity region 172 179 N/A INTRINSIC
HOLI 195 353 7.29e-47 SMART
low complexity region 388 399 N/A INTRINSIC
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are less inclined to build nests, spend more time in a passive state during the forced swim test, and display a reduction in energy expenditure and night time activity that results in increased body weight despite adecreased intake of food and water. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Hnf4g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hnf4g APN 3 3648082 missense probably benign
IGL00832:Hnf4g APN 3 3641276 missense probably damaging 1.00
IGL01571:Hnf4g APN 3 3651266 splice site probably benign
IGL01896:Hnf4g APN 3 3651410 missense probably damaging 1.00
IGL02068:Hnf4g APN 3 3644576 missense probably benign
IGL03040:Hnf4g APN 3 3634211 utr 5 prime probably benign
IGL03097:Hnf4g UTSW 3 3651614 missense probably damaging 1.00
R0124:Hnf4g UTSW 3 3643082 splice site probably benign
R0477:Hnf4g UTSW 3 3651791 splice site probably benign
R0512:Hnf4g UTSW 3 3651622 missense probably damaging 1.00
R0744:Hnf4g UTSW 3 3651629 missense possibly damaging 0.92
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1323:Hnf4g UTSW 3 3634221 missense possibly damaging 0.73
R1656:Hnf4g UTSW 3 3652951 missense probably benign
R1982:Hnf4g UTSW 3 3638208 missense probably damaging 0.99
R2336:Hnf4g UTSW 3 3641224 missense probably benign 0.25
R3104:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3105:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3106:Hnf4g UTSW 3 3652856 missense probably benign 0.42
R3843:Hnf4g UTSW 3 3651302 missense probably benign 0.09
R4200:Hnf4g UTSW 3 3651284 missense possibly damaging 0.94
R4248:Hnf4g UTSW 3 3652849 missense possibly damaging 0.69
R4418:Hnf4g UTSW 3 3648094 missense possibly damaging 0.66
R4756:Hnf4g UTSW 3 3643009 missense possibly damaging 0.69
R4871:Hnf4g UTSW 3 3651388 missense possibly damaging 0.94
R5022:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5023:Hnf4g UTSW 3 3644587 missense probably damaging 0.99
R5604:Hnf4g UTSW 3 3657126 nonsense probably null
R6746:Hnf4g UTSW 3 3657110 nonsense probably null
R7088:Hnf4g UTSW 3 3648125 splice site probably null
R7335:Hnf4g UTSW 3 3652864 missense possibly damaging 0.93
R8153:Hnf4g UTSW 3 3634190 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGGTGAGAATGCTCTGC -3'
(R):5'- TCTTATAACAGCACCATGAAGAAGC -3'

Sequencing Primer
(F):5'- TGAGAATGCTCTGCCATTAGC -3'
(R):5'- CCATGAAGAAGCCTTGCCTG -3'
Posted On2016-06-06