Incidental Mutation 'R5088:Dnaic1'
ID387561
Institutional Source Beutler Lab
Gene Symbol Dnaic1
Ensembl Gene ENSMUSG00000061322
Gene Namedynein, axonemal, intermediate chain 1
Synonyms
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41569775-41638158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41597630 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 38 (S38T)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963]
Predicted Effect probably benign
Transcript: ENSMUST00000102963
AA Change: S38T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: S38T

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Dnaic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnaic1 APN 4 41602917 missense probably benign 0.03
IGL02825:Dnaic1 APN 4 41625101 splice site probably benign
IGL03072:Dnaic1 APN 4 41602979 missense probably benign 0.00
H8562:Dnaic1 UTSW 4 41629833 missense possibly damaging 0.81
R0114:Dnaic1 UTSW 4 41605686 splice site probably benign
R0138:Dnaic1 UTSW 4 41629814 missense possibly damaging 0.49
R0153:Dnaic1 UTSW 4 41635162 unclassified probably benign
R0465:Dnaic1 UTSW 4 41629988 unclassified probably null
R0550:Dnaic1 UTSW 4 41596274 nonsense probably null
R0555:Dnaic1 UTSW 4 41625335 missense possibly damaging 0.64
R0890:Dnaic1 UTSW 4 41604253 missense possibly damaging 0.69
R0928:Dnaic1 UTSW 4 41602566 missense possibly damaging 0.57
R0944:Dnaic1 UTSW 4 41629997 missense probably benign
R1714:Dnaic1 UTSW 4 41632164 missense probably benign 0.12
R1902:Dnaic1 UTSW 4 41625319 nonsense probably null
R1919:Dnaic1 UTSW 4 41570020 critical splice donor site probably null
R1983:Dnaic1 UTSW 4 41603232 missense probably benign
R2036:Dnaic1 UTSW 4 41632225 missense probably damaging 1.00
R2306:Dnaic1 UTSW 4 41625239 missense probably benign
R2925:Dnaic1 UTSW 4 41597919 missense probably damaging 1.00
R3404:Dnaic1 UTSW 4 41603246 missense probably benign 0.00
R3720:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3721:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3722:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3931:Dnaic1 UTSW 4 41604229 missense probably damaging 1.00
R4330:Dnaic1 UTSW 4 41637966 missense probably damaging 1.00
R4755:Dnaic1 UTSW 4 41610269 missense probably damaging 0.99
R4905:Dnaic1 UTSW 4 41614269 missense probably benign 0.05
R4997:Dnaic1 UTSW 4 41597919 missense possibly damaging 0.80
R5088:Dnaic1 UTSW 4 41632251 missense probably benign 0.02
R5970:Dnaic1 UTSW 4 41625281 missense probably benign 0.14
R5987:Dnaic1 UTSW 4 41632391 missense probably benign 0.03
R6247:Dnaic1 UTSW 4 41605775 missense probably benign
R6727:Dnaic1 UTSW 4 41625308 missense probably benign
R6874:Dnaic1 UTSW 4 41632412 missense probably damaging 1.00
R6914:Dnaic1 UTSW 4 41625176 missense probably benign 0.01
R7508:Dnaic1 UTSW 4 41614323 missense probably benign 0.01
R7831:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7832:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R7914:Dnaic1 UTSW 4 41614695 critical splice donor site probably null
R7915:Dnaic1 UTSW 4 41605823 missense probably benign 0.42
R8065:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
R8067:Dnaic1 UTSW 4 41614258 missense probably damaging 1.00
X0065:Dnaic1 UTSW 4 41629868 missense possibly damaging 0.89
Z1176:Dnaic1 UTSW 4 41614323 missense probably benign 0.32
Z1177:Dnaic1 UTSW 4 41569809 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGACATCAACAGGTCCTTCAG -3'
(R):5'- CATCATCTCTGAGACTTAGGGCC -3'

Sequencing Primer
(F):5'- ACAGGTCCTTCAGAGTCTTCCATAAG -3'
(R):5'- TCTGAGACTTAGGGCCCCAGG -3'
Posted On2016-06-06