Incidental Mutation 'R5088:Mrpl37'
ID387565
Institutional Source Beutler Lab
Gene Symbol Mrpl37
Ensembl Gene ENSMUSG00000028622
Gene Namemitochondrial ribosomal protein L37
Synonyms2300004O14Rik, MRP-L2, Rpml2
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107055874-107066868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107064722 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 132 (L132H)
Ref Sequence ENSEMBL: ENSMUSP00000030365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000030365] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000145324] [ENSMUST00000149453] [ENSMUST00000154283]
Predicted Effect probably benign
Transcript: ENSMUST00000030364
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030365
AA Change: L132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030365
Gene: ENSMUSG00000028622
AA Change: L132H

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PDCD9 292 420 6.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106758
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125397
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141150
Predicted Effect probably benign
Transcript: ENSMUST00000145324
SMART Domains Protein: ENSMUSP00000122502
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154283
SMART Domains Protein: ENSMUSP00000119366
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156406
Meta Mutation Damage Score 0.9129 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Mrpl37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Mrpl37 APN 4 107060532 missense probably damaging 0.96
IGL02451:Mrpl37 APN 4 107066642 missense probably damaging 1.00
R0088:Mrpl37 UTSW 4 107064424 missense possibly damaging 0.65
R0271:Mrpl37 UTSW 4 107066461 missense possibly damaging 0.80
R1445:Mrpl37 UTSW 4 107064495 missense probably benign 0.00
R2566:Mrpl37 UTSW 4 107064493 missense possibly damaging 0.95
R4751:Mrpl37 UTSW 4 107057475 missense probably damaging 1.00
R5664:Mrpl37 UTSW 4 107064391 missense probably benign 0.06
R5870:Mrpl37 UTSW 4 107066722 missense probably benign
R5996:Mrpl37 UTSW 4 107066507 missense probably benign
R6163:Mrpl37 UTSW 4 107064596 missense possibly damaging 0.94
R7287:Mrpl37 UTSW 4 107060520 missense probably damaging 1.00
X0067:Mrpl37 UTSW 4 107066479 missense possibly damaging 0.93
Z1176:Mrpl37 UTSW 4 107057426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCTGTCCACAATGAG -3'
(R):5'- AAACCAGAGTCCCTTGAGGC -3'

Sequencing Primer
(F):5'- CACAATGAGTGGGCTTGGAG -3'
(R):5'- GAGGCAGCCTTTTCTCTGG -3'
Posted On2016-06-06