Incidental Mutation 'R5088:Skint7'
ID387567
Institutional Source Beutler Lab
Gene Symbol Skint7
Ensembl Gene ENSMUSG00000049214
Gene Nameselection and upkeep of intraepithelial T cells 7
Synonyms
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111972923-111988223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111980430 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000127347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055014] [ENSMUST00000106568] [ENSMUST00000163281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055014
AA Change: I135T

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054822
Gene: ENSMUSG00000049214
AA Change: I135T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106568
AA Change: I135T

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102178
Gene: ENSMUSG00000049214
AA Change: I135T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142162
Predicted Effect possibly damaging
Transcript: ENSMUST00000163281
AA Change: I135T

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127347
Gene: ENSMUSG00000049214
AA Change: I135T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 7.82e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Skint7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Skint7 APN 4 111982205 missense probably damaging 1.00
IGL01697:Skint7 APN 4 111980457 splice site probably benign
IGL01961:Skint7 APN 4 111977463 missense probably benign 0.01
IGL02232:Skint7 APN 4 111982028 missense possibly damaging 0.70
IGL02675:Skint7 APN 4 111981981 missense probably benign 0.03
IGL02729:Skint7 APN 4 111982170 missense probably benign 0.01
IGL02887:Skint7 APN 4 111982178 missense possibly damaging 0.70
ratio UTSW 4 111984876 splice site probably null
R0315:Skint7 UTSW 4 111988118 missense possibly damaging 0.61
R0401:Skint7 UTSW 4 111980362 missense probably damaging 0.96
R0545:Skint7 UTSW 4 111980198 missense probably benign 0.08
R0607:Skint7 UTSW 4 111977459 nonsense probably null
R0685:Skint7 UTSW 4 111980345 missense possibly damaging 0.71
R1130:Skint7 UTSW 4 111984158 missense probably benign 0.23
R1340:Skint7 UTSW 4 111980219 missense probably damaging 1.00
R1350:Skint7 UTSW 4 111980324 missense possibly damaging 0.78
R1764:Skint7 UTSW 4 111982073 missense probably benign 0.00
R1804:Skint7 UTSW 4 111982012 missense probably damaging 1.00
R2005:Skint7 UTSW 4 111984850 missense probably benign 0.13
R2084:Skint7 UTSW 4 111980178 missense probably damaging 0.99
R4651:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R4652:Skint7 UTSW 4 111982112 missense probably damaging 1.00
R5070:Skint7 UTSW 4 111984134 missense probably damaging 1.00
R5096:Skint7 UTSW 4 111981955 missense probably damaging 0.98
R5311:Skint7 UTSW 4 111980304 missense probably damaging 0.99
R5524:Skint7 UTSW 4 111980349 missense probably damaging 1.00
R5777:Skint7 UTSW 4 111988092 missense probably benign 0.29
R6208:Skint7 UTSW 4 111984876 splice site probably null
R6369:Skint7 UTSW 4 111980293 missense probably benign 0.16
R6752:Skint7 UTSW 4 111980266 missense probably benign 0.21
R7396:Skint7 UTSW 4 111988127 missense probably benign
R7633:Skint7 UTSW 4 111984140 missense probably benign 0.27
R7840:Skint7 UTSW 4 111982226 missense probably benign
R7923:Skint7 UTSW 4 111982226 missense probably benign
R8054:Skint7 UTSW 4 111982229 missense probably benign
Z1176:Skint7 UTSW 4 111980129 missense probably benign 0.01
Z1177:Skint7 UTSW 4 111980235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCAGGAGTGGCCATTC -3'
(R):5'- GATGCCTCAATGTTTCAGTGTTATC -3'

Sequencing Primer
(F):5'- TTCAGGAGTGGCCATTCCCAAC -3'
(R):5'- CATCACGACATAATTAG -3'
Posted On2016-06-06