Incidental Mutation 'R5088:Col16a1'
ID387568
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130079195 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 643 (T643M)
Ref Sequence ENSEMBL: ENSMUSP00000120339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
Predicted Effect unknown
Transcript: ENSMUST00000044565
AA Change: T958M
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690
AA Change: T958M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129937
Predicted Effect unknown
Transcript: ENSMUST00000143432
AA Change: T942M
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690
AA Change: T942M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143577
AA Change: T643M

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690
AA Change: T643M

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151541
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0395:Col16a1 UTSW 4 130073109 missense probably damaging 1.00
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R0573:Col16a1 UTSW 4 130068475 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1759:Col16a1 UTSW 4 130084269 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1862:Col16a1 UTSW 4 130092782 critical splice donor site probably null
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7375:Col16a1 UTSW 4 130065501 missense unknown
R7703:Col16a1 UTSW 4 130096502 missense unknown
R7808:Col16a1 UTSW 4 130073264 missense unknown
R7904:Col16a1 UTSW 4 130054208 nonsense probably null
R7987:Col16a1 UTSW 4 130054208 nonsense probably null
R8161:Col16a1 UTSW 4 130060469 missense unknown
R8178:Col16a1 UTSW 4 130053477 missense unknown
RF014:Col16a1 UTSW 4 130093067 critical splice acceptor site probably benign
Z1176:Col16a1 UTSW 4 130072878 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAATTGCTGTGATCGGGTC -3'
(R):5'- CTCAGTCTCTACCAGATGGAGATG -3'

Sequencing Primer
(F):5'- TGTGATCGGGTCCCCTGAG -3'
(R):5'- CTACCAGATGGAGATGGCGGG -3'
Posted On2016-06-06