Incidental Mutation 'R5088:Chd9'
ID387577
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90977519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 694 (I694V)
Ref Sequence ENSEMBL: ENSMUSP00000147407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000209746] [ENSMUST00000210947] [ENSMUST00000211403]
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: I694V
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: I694V

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: I694V
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: I694V

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209203
AA Change: I694V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209341
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: I694V
Predicted Effect probably benign
Transcript: ENSMUST00000209746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210887
Predicted Effect possibly damaging
Transcript: ENSMUST00000210947
AA Change: I221V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211403
Meta Mutation Damage Score 0.3145 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
hovel UTSW 8 91015204 missense probably benign 0.19
shack UTSW 8 90932798 missense probably damaging 1.00
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1570:Chd9 UTSW 8 91036542 missense probably benign 0.03
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1624:Chd9 UTSW 8 90998535 missense probably benign 0.17
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4125:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4628:Chd9 UTSW 8 90983463 missense probably benign 0.05
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91015249 missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
R7043:Chd9 UTSW 8 91034215 utr 3 prime probably benign
R7094:Chd9 UTSW 8 90989561 missense unknown
R7126:Chd9 UTSW 8 91015225 missense unknown
R7182:Chd9 UTSW 8 91006622 missense unknown
R7219:Chd9 UTSW 8 91001766 missense unknown
R7260:Chd9 UTSW 8 90994543 missense unknown
R7293:Chd9 UTSW 8 91034079 missense unknown
R7303:Chd9 UTSW 8 91051904 missense unknown
R7358:Chd9 UTSW 8 90983487 missense unknown
R7358:Chd9 UTSW 8 91034218 missense unknown
R7451:Chd9 UTSW 8 91033790 frame shift probably null
R7451:Chd9 UTSW 8 91033818 missense probably benign 0.27
R7456:Chd9 UTSW 8 90932525 nonsense probably null
R7481:Chd9 UTSW 8 90956438 missense unknown
R7532:Chd9 UTSW 8 90994565 missense unknown
R7570:Chd9 UTSW 8 90994580 missense unknown
R7611:Chd9 UTSW 8 91036389 missense probably damaging 1.00
R7673:Chd9 UTSW 8 91051697 missense probably damaging 0.96
R7723:Chd9 UTSW 8 91015209 missense unknown
R7739:Chd9 UTSW 8 91035025 missense probably damaging 1.00
R7759:Chd9 UTSW 8 90977550 critical splice donor site probably null
RF007:Chd9 UTSW 8 91033950 missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGAGAATAAGACTTGTTTCTCG -3'
(R):5'- TCTGAAGACAGCTACAGTGTAC -3'

Sequencing Primer
(F):5'- GAATAAGACTTGTTTCTCGTTCCTG -3'
(R):5'- CTACAGTGTACTCACATATAATAAG -3'
Posted On2016-06-06