Incidental Mutation 'R5088:Olfr849'
ID387579
Institutional Source Beutler Lab
Gene Symbol Olfr849
Ensembl Gene ENSMUSG00000052182
Gene Nameolfactory receptor 849
SynonymsMOR151-1, GA_x6K02T2PVTD-13176842-13177780
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19440266-19446923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19441771 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 286 (N286S)
Ref Sequence ENSEMBL: ENSMUSP00000149769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063923] [ENSMUST00000217273]
Predicted Effect probably damaging
Transcript: ENSMUST00000063923
AA Change: N286S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064123
Gene: ENSMUSG00000052182
AA Change: N286S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157237
Predicted Effect probably damaging
Transcript: ENSMUST00000217273
AA Change: N286S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Olfr849
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr849 APN 9 19440970 missense probably benign 0.01
IGL01599:Olfr849 APN 9 19441815 missense probably benign 0.00
IGL01885:Olfr849 APN 9 19441464 missense probably benign 0.01
IGL02258:Olfr849 APN 9 19440997 missense possibly damaging 0.66
IGL02258:Olfr849 APN 9 19440999 missense probably benign 0.00
IGL02282:Olfr849 APN 9 19441618 missense probably benign 0.42
R1293:Olfr849 UTSW 9 19441432 missense probably benign 0.27
R1931:Olfr849 UTSW 9 19441351 missense possibly damaging 0.93
R2444:Olfr849 UTSW 9 19441015 missense possibly damaging 0.78
R4181:Olfr849 UTSW 9 19441735 missense possibly damaging 0.86
R4231:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4233:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4236:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4302:Olfr849 UTSW 9 19440999 missense probably benign 0.00
R4651:Olfr849 UTSW 9 19441295 nonsense probably null
R5006:Olfr849 UTSW 9 19441249 missense probably benign 0.30
R5501:Olfr849 UTSW 9 19440994 missense possibly damaging 0.93
R6775:Olfr849 UTSW 9 19441422 missense possibly damaging 0.56
R7038:Olfr849 UTSW 9 19441592 missense possibly damaging 0.88
R8010:Olfr849 UTSW 9 19441692 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCTAGTTTACACAGTGTCTGTTC -3'
(R):5'- CCTTCTGAGGAACATAGTAGGTG -3'

Sequencing Primer
(F):5'- GTTTTAAAAATGTCATCATTGGGAGG -3'
(R):5'- CTGAGGAACATAGTAGGTGAATTTTC -3'
Posted On2016-06-06