Incidental Mutation 'R5088:Hykk'
ID 387581
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Name hydroxylysine kinase 1
Synonyms Agphd1, C630028N24Rik
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5088 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 54917283-54949924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54946479 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 362 (I362V)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034848] [ENSMUST00000039742] [ENSMUST00000054018] [ENSMUST00000171900] [ENSMUST00000172407]
AlphaFold Q5U5V2
Predicted Effect probably benign
Transcript: ENSMUST00000034848
SMART Domains Protein: ENSMUSP00000034848
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 216 1.5e-57 PFAM
low complexity region 238 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039742
AA Change: I362V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: I362V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054018
SMART Domains Protein: ENSMUSP00000049861
Gene: ENSMUSG00000044820

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171578
Predicted Effect probably benign
Transcript: ENSMUST00000171900
SMART Domains Protein: ENSMUSP00000132368
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 139 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172407
SMART Domains Protein: ENSMUSP00000126844
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 210 3.2e-56 PFAM
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Wdr24 T A 17: 25,828,207 probably null Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54920558 missense possibly damaging 0.83
IGL02890:Hykk APN 9 54920711 missense probably benign 0.04
hike UTSW 9 54946479 missense probably benign 0.00
spatziergangen UTSW 9 54920726 missense possibly damaging 0.53
BB001:Hykk UTSW 9 54922240 missense probably damaging 1.00
BB011:Hykk UTSW 9 54922240 missense probably damaging 1.00
R0070:Hykk UTSW 9 54922348 splice site probably benign
R0734:Hykk UTSW 9 54946432 missense possibly damaging 0.93
R0830:Hykk UTSW 9 54937317 missense probably damaging 1.00
R1905:Hykk UTSW 9 54946383 missense probably benign
R2322:Hykk UTSW 9 54946134 missense probably benign 0.00
R4632:Hykk UTSW 9 54946516 missense probably benign 0.01
R4846:Hykk UTSW 9 54920606 missense probably damaging 1.00
R5410:Hykk UTSW 9 54946066 missense probably damaging 1.00
R6292:Hykk UTSW 9 54920826 critical splice donor site probably null
R6416:Hykk UTSW 9 54946359 missense probably benign 0.03
R6983:Hykk UTSW 9 54946509 missense probably benign 0.00
R7261:Hykk UTSW 9 54920726 missense possibly damaging 0.53
R7276:Hykk UTSW 9 54946218 missense probably damaging 1.00
R7924:Hykk UTSW 9 54922240 missense probably damaging 1.00
R8539:Hykk UTSW 9 54937160 missense probably benign 0.00
Z1177:Hykk UTSW 9 54946429 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGTAGAGAGGCAGGCTTTG -3'
(R):5'- ACACAAGCTTTTCTAAGGTCACT -3'

Sequencing Primer
(F):5'- AGAGAGGCAGGCTTTGTTTTTAC -3'
(R):5'- GCAATTGACCTGCTTAGGGC -3'
Posted On 2016-06-06