Incidental Mutation 'R5088:Hykk'
ID 387581
Institutional Source Beutler Lab
Gene Symbol Hykk
Ensembl Gene ENSMUSG00000035878
Gene Name hydroxylysine kinase 1
Synonyms C630028N24Rik, Agphd1
MMRRC Submission 042677-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R5088 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 54824574-54857208 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54853763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 362 (I362V)
Ref Sequence ENSEMBL: ENSMUSP00000039980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034848] [ENSMUST00000039742] [ENSMUST00000054018] [ENSMUST00000171900] [ENSMUST00000172407]
AlphaFold Q5U5V2
Predicted Effect probably benign
Transcript: ENSMUST00000034848
SMART Domains Protein: ENSMUSP00000034848
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 216 1.5e-57 PFAM
low complexity region 238 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039742
AA Change: I362V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878
AA Change: I362V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054018
SMART Domains Protein: ENSMUSP00000049861
Gene: ENSMUSG00000044820

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171578
Predicted Effect probably benign
Transcript: ENSMUST00000171900
SMART Domains Protein: ENSMUSP00000132368
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 139 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172407
SMART Domains Protein: ENSMUSP00000126844
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 210 3.2e-56 PFAM
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,883,939 (GRCm39) C640S probably damaging Het
4931429L15Rik T C 9: 46,217,038 (GRCm39) R246G probably benign Het
Aak1 T C 6: 86,921,462 (GRCm39) probably null Het
Abcc5 A G 16: 20,195,412 (GRCm39) L695P probably damaging Het
Alcam T A 16: 52,109,290 (GRCm39) T328S probably damaging Het
Alpk1 A G 3: 127,478,969 (GRCm39) probably benign Het
Arel1 A G 12: 84,970,889 (GRCm39) L642P probably damaging Het
Atrip T C 9: 108,888,964 (GRCm39) D741G probably damaging Het
Bmp1 T C 14: 70,723,659 (GRCm39) T726A possibly damaging Het
Bnip3 A G 7: 138,496,337 (GRCm39) probably null Het
Cacng5 C G 11: 107,768,215 (GRCm39) C264S possibly damaging Het
Calr4 T A 4: 109,101,859 (GRCm39) probably benign Het
Cdhr1 T A 14: 36,811,422 (GRCm39) T230S probably benign Het
Cdk16 T C X: 20,562,566 (GRCm39) probably benign Het
Cenpj T C 14: 56,791,148 (GRCm39) E337G probably damaging Het
Chd9 A G 8: 91,704,147 (GRCm39) I694V possibly damaging Het
Chsy3 T A 18: 59,312,607 (GRCm39) V360D probably damaging Het
Col16a1 C T 4: 129,972,988 (GRCm39) T643M probably benign Het
Col5a1 G A 2: 27,908,614 (GRCm39) W67* probably null Het
Cyp20a1 A T 1: 60,402,509 (GRCm39) H198L probably damaging Het
Dnai1 T A 4: 41,597,630 (GRCm39) S38T probably benign Het
Dnai1 T G 4: 41,632,251 (GRCm39) S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 (GRCm39) T188K probably damaging Het
Ergic2 A G 6: 148,084,621 (GRCm39) V304A probably damaging Het
Fam83a A G 15: 57,873,196 (GRCm39) T342A probably benign Het
Fbxo7 A G 10: 85,857,784 (GRCm39) probably benign Het
Gins4 T C 8: 23,727,084 (GRCm39) E3G possibly damaging Het
Glis3 G A 19: 28,508,979 (GRCm39) P335L probably benign Het
Golph3l A T 3: 95,524,501 (GRCm39) T251S possibly damaging Het
Hnf4g C T 3: 3,722,181 (GRCm39) A445V probably benign Het
Il6st G A 13: 112,627,089 (GRCm39) V294M probably damaging Het
Itpr1 A G 6: 108,366,348 (GRCm39) I92V probably damaging Het
Kdm4c T C 4: 74,252,936 (GRCm39) L501P probably benign Het
Mpi G A 9: 57,457,887 (GRCm39) T105M probably damaging Het
Mrpl37 A T 4: 106,921,919 (GRCm39) L132H probably damaging Het
Muc5ac A T 7: 141,350,056 (GRCm39) T600S possibly damaging Het
Npl A T 1: 153,384,890 (GRCm39) I249N possibly damaging Het
Or10j27 C T 1: 172,958,606 (GRCm39) M59I probably damaging Het
Or7g30 A G 9: 19,353,067 (GRCm39) N286S probably damaging Het
Pkd1 A G 17: 24,809,812 (GRCm39) K3497E possibly damaging Het
Ptprt T C 2: 162,080,095 (GRCm39) N235D probably benign Het
Rangap1 A C 15: 81,594,664 (GRCm39) D388E probably benign Het
Rcvrn A T 11: 67,586,340 (GRCm39) Q33L probably benign Het
Rif1 A T 2: 51,982,307 (GRCm39) K524I possibly damaging Het
Rnf139 A T 15: 58,771,790 (GRCm39) N605I possibly damaging Het
Ryr2 C A 13: 11,727,129 (GRCm39) G2411* probably null Het
Scn3a A T 2: 65,302,643 (GRCm39) S1268T probably damaging Het
Sema6a T A 18: 47,382,196 (GRCm39) I784F probably damaging Het
Sgms2 C T 3: 131,124,005 (GRCm39) V232M probably benign Het
Skint7 T C 4: 111,837,627 (GRCm39) I135T possibly damaging Het
Smchd1 A T 17: 71,738,343 (GRCm39) N507K possibly damaging Het
Spata31d1a A C 13: 59,848,966 (GRCm39) probably null Het
Spata7 A T 12: 98,635,761 (GRCm39) D527V probably benign Het
Srcap A G 7: 127,140,833 (GRCm39) T1477A probably benign Het
Srl C A 16: 4,300,633 (GRCm39) D375Y probably damaging Het
Stk4 A T 2: 163,925,608 (GRCm39) K58* probably null Het
Svep1 T G 4: 58,120,648 (GRCm39) H795P possibly damaging Het
Trak2 T A 1: 58,974,967 (GRCm39) Q75L probably benign Het
Ubxn2a T A 12: 4,933,904 (GRCm39) N169I probably damaging Het
Vmn1r216 T A 13: 23,283,473 (GRCm39) L52* probably null Het
Vmn2r108 A T 17: 20,690,454 (GRCm39) N459K possibly damaging Het
Vstm5 A G 9: 15,168,601 (GRCm39) D55G possibly damaging Het
Wdr24 T A 17: 26,047,181 (GRCm39) probably null Het
Zfp13 C A 17: 23,796,035 (GRCm39) E179* probably null Het
Zfp839 T C 12: 110,834,610 (GRCm39) S546P probably damaging Het
Other mutations in Hykk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Hykk APN 9 54,827,842 (GRCm39) missense possibly damaging 0.83
IGL02890:Hykk APN 9 54,827,995 (GRCm39) missense probably benign 0.04
hike UTSW 9 54,853,763 (GRCm39) missense probably benign 0.00
spatziergangen UTSW 9 54,828,010 (GRCm39) missense possibly damaging 0.53
BB001:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
BB011:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
R0070:Hykk UTSW 9 54,829,632 (GRCm39) splice site probably benign
R0734:Hykk UTSW 9 54,853,716 (GRCm39) missense possibly damaging 0.93
R0830:Hykk UTSW 9 54,844,601 (GRCm39) missense probably damaging 1.00
R1905:Hykk UTSW 9 54,853,667 (GRCm39) missense probably benign
R2322:Hykk UTSW 9 54,853,418 (GRCm39) missense probably benign 0.00
R4632:Hykk UTSW 9 54,853,800 (GRCm39) missense probably benign 0.01
R4846:Hykk UTSW 9 54,827,890 (GRCm39) missense probably damaging 1.00
R5410:Hykk UTSW 9 54,853,350 (GRCm39) missense probably damaging 1.00
R6292:Hykk UTSW 9 54,828,110 (GRCm39) critical splice donor site probably null
R6416:Hykk UTSW 9 54,853,643 (GRCm39) missense probably benign 0.03
R6983:Hykk UTSW 9 54,853,793 (GRCm39) missense probably benign 0.00
R7261:Hykk UTSW 9 54,828,010 (GRCm39) missense possibly damaging 0.53
R7276:Hykk UTSW 9 54,853,502 (GRCm39) missense probably damaging 1.00
R7924:Hykk UTSW 9 54,829,524 (GRCm39) missense probably damaging 1.00
R8539:Hykk UTSW 9 54,844,444 (GRCm39) missense probably benign 0.00
R9646:Hykk UTSW 9 54,853,521 (GRCm39) missense probably benign 0.02
Z1177:Hykk UTSW 9 54,853,713 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGTAGAGAGGCAGGCTTTG -3'
(R):5'- ACACAAGCTTTTCTAAGGTCACT -3'

Sequencing Primer
(F):5'- AGAGAGGCAGGCTTTGTTTTTAC -3'
(R):5'- GCAATTGACCTGCTTAGGGC -3'
Posted On 2016-06-06