Incidental Mutation 'R5088:Wdr24'
ID387607
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene NameWD repeat domain 24
Synonyms
MMRRC Submission 042677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5088 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25823627-25828730 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 25828207 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably null
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000026833
AA Change: N691K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: N691K

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123560
Predicted Effect probably null
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably null
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,073 C640S probably damaging Het
4931429L15Rik T C 9: 46,305,740 R246G probably benign Het
Aak1 T C 6: 86,944,480 probably null Het
Abcc5 A G 16: 20,376,662 L695P probably damaging Het
Alcam T A 16: 52,288,927 T328S probably damaging Het
Alpk1 A G 3: 127,685,320 probably benign Het
Arel1 A G 12: 84,924,115 L642P probably damaging Het
Atrip T C 9: 109,059,896 D741G probably damaging Het
Bmp1 T C 14: 70,486,219 T726A possibly damaging Het
Bnip3 A G 7: 138,894,608 probably null Het
Cacng5 C G 11: 107,877,389 C264S possibly damaging Het
Calr4 T A 4: 109,244,662 probably benign Het
Cdhr1 T A 14: 37,089,465 T230S probably benign Het
Cdk16 T C X: 20,696,327 probably benign Het
Cenpj T C 14: 56,553,691 E337G probably damaging Het
Chd9 A G 8: 90,977,519 I694V possibly damaging Het
Chsy3 T A 18: 59,179,535 V360D probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cyp20a1 A T 1: 60,363,350 H198L probably damaging Het
Dnaic1 T A 4: 41,597,630 S38T probably benign Het
Dnaic1 T G 4: 41,632,251 S562A probably benign Het
Dpy19l4 G T 4: 11,303,357 T188K probably damaging Het
Ergic2 A G 6: 148,183,123 V304A probably damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbxo7 A G 10: 86,021,920 probably benign Het
Gins4 T C 8: 23,237,068 E3G possibly damaging Het
Glis3 G A 19: 28,531,579 P335L probably benign Het
Golph3l A T 3: 95,617,190 T251S possibly damaging Het
Hnf4g C T 3: 3,657,121 A445V probably benign Het
Hykk A G 9: 54,946,479 I362V probably benign Het
Il6st G A 13: 112,490,555 V294M probably damaging Het
Itpr1 A G 6: 108,389,387 I92V probably damaging Het
Kdm4c T C 4: 74,334,699 L501P probably benign Het
Mpi G A 9: 57,550,604 T105M probably damaging Het
Mrpl37 A T 4: 107,064,722 L132H probably damaging Het
Muc5ac A T 7: 141,796,319 T600S possibly damaging Het
Npl A T 1: 153,509,144 I249N possibly damaging Het
Olfr1408 C T 1: 173,131,039 M59I probably damaging Het
Olfr849 A G 9: 19,441,771 N286S probably damaging Het
Pkd1 A G 17: 24,590,838 K3497E possibly damaging Het
Ptprt T C 2: 162,238,175 N235D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Rcvrn A T 11: 67,695,514 Q33L probably benign Het
Rif1 A T 2: 52,092,295 K524I possibly damaging Het
Rnf139 A T 15: 58,899,941 N605I possibly damaging Het
Ryr2 C A 13: 11,712,243 G2411* probably null Het
Scn3a A T 2: 65,472,299 S1268T probably damaging Het
Sema6a T A 18: 47,249,129 I784F probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Skint7 T C 4: 111,980,430 I135T possibly damaging Het
Smchd1 A T 17: 71,431,348 N507K possibly damaging Het
Spata31d1a A C 13: 59,701,152 probably null Het
Spata7 A T 12: 98,669,502 D527V probably benign Het
Srcap A G 7: 127,541,661 T1477A probably benign Het
Srl C A 16: 4,482,769 D375Y probably damaging Het
Stk4 A T 2: 164,083,688 K58* probably null Het
Svep1 T G 4: 58,120,648 H795P possibly damaging Het
Trak2 T A 1: 58,935,808 Q75L probably benign Het
Ubxn2a T A 12: 4,883,904 N169I probably damaging Het
Vmn1r216 T A 13: 23,099,303 L52* probably null Het
Vmn2r108 A T 17: 20,470,192 N459K possibly damaging Het
Vstm5 A G 9: 15,257,305 D55G possibly damaging Het
Zfp13 C A 17: 23,577,061 E179* probably null Het
Zfp839 T C 12: 110,868,176 S546P probably damaging Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 25826621 missense probably benign 0.20
IGL01700:Wdr24 APN 17 25825828 missense probably damaging 1.00
IGL01763:Wdr24 APN 17 25826190 missense probably benign 0.20
IGL02567:Wdr24 APN 17 25824348 missense probably damaging 0.99
IGL03100:Wdr24 APN 17 25825707 missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 25827113 missense probably benign
R0799:Wdr24 UTSW 17 25826128 missense probably damaging 1.00
R1015:Wdr24 UTSW 17 25828238 missense probably benign 0.12
R1276:Wdr24 UTSW 17 25827467 missense probably benign 0.02
R1297:Wdr24 UTSW 17 25827348 missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 25824266 missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 25826043 missense probably benign 0.38
R2069:Wdr24 UTSW 17 25826282 missense probably damaging 1.00
R2508:Wdr24 UTSW 17 25824299 missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 25828207 unclassified probably null
R4604:Wdr24 UTSW 17 25828505 missense probably damaging 1.00
R4894:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R5068:Wdr24 UTSW 17 25825779 missense possibly damaging 0.77
R5104:Wdr24 UTSW 17 25824591 missense probably damaging 1.00
R5498:Wdr24 UTSW 17 25824561 missense probably damaging 1.00
R5719:Wdr24 UTSW 17 25828340 critical splice donor site probably null
R5892:Wdr24 UTSW 17 25827986 missense probably benign 0.00
R5975:Wdr24 UTSW 17 25827128 missense probably benign 0.37
R6084:Wdr24 UTSW 17 25824530 missense probably damaging 0.99
R6106:Wdr24 UTSW 17 25824605 missense probably benign
R6114:Wdr24 UTSW 17 25824605 missense probably benign
R6116:Wdr24 UTSW 17 25824605 missense probably benign
R6165:Wdr24 UTSW 17 25826421 missense probably benign 0.18
R6175:Wdr24 UTSW 17 25826578 missense probably damaging 1.00
R6331:Wdr24 UTSW 17 25825676 missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 25827925 missense probably damaging 0.99
R6984:Wdr24 UTSW 17 25828235 missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R7583:Wdr24 UTSW 17 25825830 missense probably null 1.00
R7770:Wdr24 UTSW 17 25827096 missense probably benign 0.04
R8086:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
X0022:Wdr24 UTSW 17 25824272 missense probably damaging 0.99
Z1177:Wdr24 UTSW 17 25825687 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACCCAGGTGTGTGATGGATC -3'
(R):5'- CAGGCCTTTAACCACATGATG -3'

Sequencing Primer
(F):5'- GTCTCCCCAGACTGGCTG -3'
(R):5'- AATGGGAGGGCTGTTCAGC -3'
Posted On2016-06-06