Incidental Mutation 'R5089:Olfr1214'
ID387619
Institutional Source Beutler Lab
Gene Symbol Olfr1214
Ensembl Gene ENSMUSG00000075110
Gene Nameolfactory receptor 1214
SynonymsGA_x6K02T2Q125-50468705-50467770, MOR233-8
MMRRC Submission 042678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5089 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88986479-88992653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88988172 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 10 (F10S)
Ref Sequence ENSEMBL: ENSMUSP00000150322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099804] [ENSMUST00000216026] [ENSMUST00000217469]
Predicted Effect probably damaging
Transcript: ENSMUST00000099804
AA Change: F10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097392
Gene: ENSMUSG00000075110
AA Change: F10S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 286 4.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216026
AA Change: F10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217469
AA Change: F10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4892 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,786,246 L176H probably damaging Het
1700030J22Rik T C 8: 116,971,933 N145S possibly damaging Het
4932438A13Rik T A 3: 36,987,502 D2676E probably benign Het
A230050P20Rik A T 9: 20,868,916 M1L probably benign Het
Acp2 T C 2: 91,211,922 probably benign Het
Adgrf2 G A 17: 42,710,097 A612V probably benign Het
Cct3 T G 3: 88,300,843 M46R probably damaging Het
Cdc123 T C 2: 5,805,000 D200G probably benign Het
Cdh9 T A 15: 16,778,276 F59Y probably damaging Het
Cluh A G 11: 74,660,372 E349G probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Crbn T C 6: 106,781,718 H381R possibly damaging Het
Crim1 A G 17: 78,374,090 D991G probably damaging Het
Dhx16 A T 17: 35,884,089 M503L probably damaging Het
Dthd1 A G 5: 62,849,905 T650A probably benign Het
Etfa T A 9: 55,488,866 K139* probably null Het
Flnc T C 6: 29,447,813 I1205T probably damaging Het
Fzd6 T A 15: 39,007,480 C32S probably damaging Het
Gm1110 T A 9: 26,882,387 D515V probably damaging Het
Gm7676 T C 8: 13,896,401 noncoding transcript Het
Gpr157 T C 4: 150,102,293 S293P possibly damaging Het
Hc T C 2: 35,024,890 D810G probably benign Het
Helz2 T C 2: 181,235,149 H1184R probably benign Het
Hoxc5 A T 15: 103,014,055 probably benign Het
Iah1 C T 12: 21,323,308 S196L possibly damaging Het
Il5 C T 11: 53,721,828 T55I possibly damaging Het
Kras T C 6: 145,225,143 K169E probably benign Het
Larp1 C A 11: 58,047,867 T492K possibly damaging Het
Lgr5 T C 10: 115,478,423 D203G probably damaging Het
Lpcat2 G A 8: 92,879,443 V241M probably damaging Het
Mpeg1 G A 19: 12,462,997 M606I probably benign Het
Ms4a1 G A 19: 11,258,812 P4S probably benign Het
Nat10 A T 2: 103,757,143 probably benign Het
Ncaph2 T A 15: 89,355,945 probably null Het
Nfat5 T A 8: 107,351,438 V403D probably damaging Het
Olfr1380 T A 11: 49,564,413 M164K possibly damaging Het
Pax7 T C 4: 139,830,265 H65R probably damaging Het
Phf20 C A 2: 156,302,862 H797N probably benign Het
Pkhd1l1 T A 15: 44,591,887 S4015T probably benign Het
Prdm5 C T 6: 65,856,090 H148Y probably benign Het
Prpf8 A G 11: 75,509,228 probably null Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sardh A G 2: 27,239,613 probably null Het
Serpinb6b G A 13: 32,978,150 E192K probably benign Het
Skor1 A G 9: 63,145,923 S216P probably damaging Het
Slc51a A G 16: 32,477,546 probably null Het
Smarcb1 T C 10: 75,915,179 T74A probably benign Het
Spg11 A T 2: 122,114,717 Y107* probably null Het
Stk25 T A 1: 93,624,608 K350M probably benign Het
Syne1 C T 10: 5,405,444 W379* probably null Het
Taco1 A T 11: 106,069,611 E126V probably benign Het
Tbc1d12 T A 19: 38,916,788 L649* probably null Het
Trpm3 G A 19: 22,766,756 G238R probably damaging Het
Yy1 C A 12: 108,793,737 Q109K probably damaging Het
Other mutations in Olfr1214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Olfr1214 APN 2 88988080 missense probably benign 0.00
IGL03409:Olfr1214 APN 2 88987587 missense possibly damaging 0.93
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0503:Olfr1214 UTSW 2 88987978 missense probably benign 0.01
R0688:Olfr1214 UTSW 2 88987595 missense probably damaging 1.00
R1120:Olfr1214 UTSW 2 88988079 missense possibly damaging 0.51
R1752:Olfr1214 UTSW 2 88987315 missense possibly damaging 0.60
R2018:Olfr1214 UTSW 2 88988145 missense probably benign 0.06
R2281:Olfr1214 UTSW 2 88987470 missense probably benign 0.03
R2509:Olfr1214 UTSW 2 88987431 missense probably damaging 1.00
R2862:Olfr1214 UTSW 2 88987320 missense probably benign
R3942:Olfr1214 UTSW 2 88988111 missense probably benign 0.15
R4894:Olfr1214 UTSW 2 88987439 missense possibly damaging 0.83
R4899:Olfr1214 UTSW 2 88988110 missense probably null 0.13
R5253:Olfr1214 UTSW 2 88988100 missense possibly damaging 0.67
R5338:Olfr1214 UTSW 2 88987465 missense possibly damaging 0.87
R6476:Olfr1214 UTSW 2 88987377 missense probably benign 0.06
R8411:Olfr1214 UTSW 2 88988065 missense probably benign 0.26
Z1177:Olfr1214 UTSW 2 88987881 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCTTAGGTGTGACAACAGAGG -3'
(R):5'- AACTCAGCCCTGCCTAGTTC -3'

Sequencing Primer
(F):5'- CTTAGGTGTGACAACAGAGGAGACAC -3'
(R):5'- CCTGCCTAGTTCCATGAAGATG -3'
Posted On2016-06-06