Incidental Mutation 'R5089:Phf20'
ID387623
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
MMRRC Submission 042678-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R5089 (G1)
Quality Score131
Status Validated
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 156302862 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 797 (H797N)
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably benign
Transcript: ENSMUST00000037401
AA Change: H797N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116
AA Change: H797N

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152617
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,786,246 L176H probably damaging Het
1700030J22Rik T C 8: 116,971,933 N145S possibly damaging Het
4932438A13Rik T A 3: 36,987,502 D2676E probably benign Het
A230050P20Rik A T 9: 20,868,916 M1L probably benign Het
Acp2 T C 2: 91,211,922 probably benign Het
Adgrf2 G A 17: 42,710,097 A612V probably benign Het
Cct3 T G 3: 88,300,843 M46R probably damaging Het
Cdc123 T C 2: 5,805,000 D200G probably benign Het
Cdh9 T A 15: 16,778,276 F59Y probably damaging Het
Cluh A G 11: 74,660,372 E349G probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Crbn T C 6: 106,781,718 H381R possibly damaging Het
Crim1 A G 17: 78,374,090 D991G probably damaging Het
Dhx16 A T 17: 35,884,089 M503L probably damaging Het
Dthd1 A G 5: 62,849,905 T650A probably benign Het
Etfa T A 9: 55,488,866 K139* probably null Het
Flnc T C 6: 29,447,813 I1205T probably damaging Het
Fzd6 T A 15: 39,007,480 C32S probably damaging Het
Gm1110 T A 9: 26,882,387 D515V probably damaging Het
Gm7676 T C 8: 13,896,401 noncoding transcript Het
Gpr157 T C 4: 150,102,293 S293P possibly damaging Het
Hc T C 2: 35,024,890 D810G probably benign Het
Helz2 T C 2: 181,235,149 H1184R probably benign Het
Hoxc5 A T 15: 103,014,055 probably benign Het
Iah1 C T 12: 21,323,308 S196L possibly damaging Het
Il5 C T 11: 53,721,828 T55I possibly damaging Het
Kras T C 6: 145,225,143 K169E probably benign Het
Larp1 C A 11: 58,047,867 T492K possibly damaging Het
Lgr5 T C 10: 115,478,423 D203G probably damaging Het
Lpcat2 G A 8: 92,879,443 V241M probably damaging Het
Mpeg1 G A 19: 12,462,997 M606I probably benign Het
Ms4a1 G A 19: 11,258,812 P4S probably benign Het
Nat10 A T 2: 103,757,143 probably benign Het
Ncaph2 T A 15: 89,355,945 probably null Het
Nfat5 T A 8: 107,351,438 V403D probably damaging Het
Olfr1214 A G 2: 88,988,172 F10S probably damaging Het
Olfr1380 T A 11: 49,564,413 M164K possibly damaging Het
Pax7 T C 4: 139,830,265 H65R probably damaging Het
Pkhd1l1 T A 15: 44,591,887 S4015T probably benign Het
Prdm5 C T 6: 65,856,090 H148Y probably benign Het
Prpf8 A G 11: 75,509,228 probably null Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sardh A G 2: 27,239,613 probably null Het
Serpinb6b G A 13: 32,978,150 E192K probably benign Het
Skor1 A G 9: 63,145,923 S216P probably damaging Het
Slc51a A G 16: 32,477,546 probably null Het
Smarcb1 T C 10: 75,915,179 T74A probably benign Het
Spg11 A T 2: 122,114,717 Y107* probably null Het
Stk25 T A 1: 93,624,608 K350M probably benign Het
Syne1 C T 10: 5,405,444 W379* probably null Het
Taco1 A T 11: 106,069,611 E126V probably benign Het
Tbc1d12 T A 19: 38,916,788 L649* probably null Het
Trpm3 G A 19: 22,766,756 G238R probably damaging Het
Yy1 C A 12: 108,793,737 Q109K probably damaging Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R0189:Phf20 UTSW 2 156303141 missense probably benign 0.02
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3011:Phf20 UTSW 2 156288026 missense probably benign 0.32
R3024:Phf20 UTSW 2 156287867 missense probably damaging 0.96
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5707:Phf20 UTSW 2 156296771 intron probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
R7698:Phf20 UTSW 2 156294138 missense probably damaging 1.00
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGATATCCCAGGTAGAGGCC -3'
(R):5'- TTTGGGATCTATGTCGCCTC -3'

Sequencing Primer
(F):5'- GCCACTGTCCCTTACTGGAGAATG -3'
(R):5'- TGACTGCAGCATCAAGGGC -3'
Posted On2016-06-06