Incidental Mutation 'R5089:Cluh'
ID 387649
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Name clustered mitochondria (cluA/CLU1) homolog
Synonyms 1300001I01Rik
MMRRC Submission 042678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R5089 (G1)
Quality Score 208
Status Validated
Chromosome 11
Chromosomal Location 74649495-74670847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74660372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 349 (E349G)
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000092915
AA Change: E349G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: E349G

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117818
AA Change: E349G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: E349G

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Meta Mutation Damage Score 0.3485 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A T 19: 58,786,246 L176H probably damaging Het
1700030J22Rik T C 8: 116,971,933 N145S possibly damaging Het
4932438A13Rik T A 3: 36,987,502 D2676E probably benign Het
A230050P20Rik A T 9: 20,868,916 M1L probably benign Het
Acp2 T C 2: 91,211,922 probably benign Het
Adgrf2 G A 17: 42,710,097 A612V probably benign Het
Cct3 T G 3: 88,300,843 M46R probably damaging Het
Cdc123 T C 2: 5,805,000 D200G probably benign Het
Cdh9 T A 15: 16,778,276 F59Y probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Crbn T C 6: 106,781,718 H381R possibly damaging Het
Crim1 A G 17: 78,374,090 D991G probably damaging Het
Dhx16 A T 17: 35,884,089 M503L probably damaging Het
Dthd1 A G 5: 62,849,905 T650A probably benign Het
Etfa T A 9: 55,488,866 K139* probably null Het
Flnc T C 6: 29,447,813 I1205T probably damaging Het
Fzd6 T A 15: 39,007,480 C32S probably damaging Het
Gm1110 T A 9: 26,882,387 D515V probably damaging Het
Gm7676 T C 8: 13,896,401 noncoding transcript Het
Gpr157 T C 4: 150,102,293 S293P possibly damaging Het
Hc T C 2: 35,024,890 D810G probably benign Het
Helz2 T C 2: 181,235,149 H1184R probably benign Het
Hoxc5 A T 15: 103,014,055 probably benign Het
Iah1 C T 12: 21,323,308 S196L possibly damaging Het
Il5 C T 11: 53,721,828 T55I possibly damaging Het
Kras T C 6: 145,225,143 K169E probably benign Het
Larp1 C A 11: 58,047,867 T492K possibly damaging Het
Lgr5 T C 10: 115,478,423 D203G probably damaging Het
Lpcat2 G A 8: 92,879,443 V241M probably damaging Het
Mpeg1 G A 19: 12,462,997 M606I probably benign Het
Ms4a1 G A 19: 11,258,812 P4S probably benign Het
Nat10 A T 2: 103,757,143 probably benign Het
Ncaph2 T A 15: 89,355,945 probably null Het
Nfat5 T A 8: 107,351,438 V403D probably damaging Het
Olfr1214 A G 2: 88,988,172 F10S probably damaging Het
Olfr1380 T A 11: 49,564,413 M164K possibly damaging Het
Pax7 T C 4: 139,830,265 H65R probably damaging Het
Phf20 C A 2: 156,302,862 H797N probably benign Het
Pkhd1l1 T A 15: 44,591,887 S4015T probably benign Het
Prdm5 C T 6: 65,856,090 H148Y probably benign Het
Prpf8 A G 11: 75,509,228 probably null Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sardh A G 2: 27,239,613 probably null Het
Serpinb6b G A 13: 32,978,150 E192K probably benign Het
Skor1 A G 9: 63,145,923 S216P probably damaging Het
Slc51a A G 16: 32,477,546 probably null Het
Smarcb1 T C 10: 75,915,179 T74A probably benign Het
Spg11 A T 2: 122,114,717 Y107* probably null Het
Stk25 T A 1: 93,624,608 K350M probably benign Het
Syne1 C T 10: 5,405,444 W379* probably null Het
Taco1 A T 11: 106,069,611 E126V probably benign Het
Tbc1d12 T A 19: 38,916,788 L649* probably null Het
Trpm3 G A 19: 22,766,756 G238R probably damaging Het
Yy1 C A 12: 108,793,737 Q109K probably damaging Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
R9061:Cluh UTSW 11 74660366 missense possibly damaging 0.73
R9326:Cluh UTSW 11 74664076 missense probably benign 0.00
RF020:Cluh UTSW 11 74669538 small insertion probably benign
RF032:Cluh UTSW 11 74669515 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAATGGTGTCCCAGTGCCTG -3'
(R):5'- CTACTGGGAGGTGCATATGAG -3'

Sequencing Primer
(F):5'- TGAGAGTCCCTAGTCCAAGG -3'
(R):5'- TGCATATGAGCCTGGCAG -3'
Posted On 2016-06-06