Incidental Mutation 'R5090:Trim55'
ID387678
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Nametripartite motif-containing 55
SynonymsD830041C10Rik, Murf2
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location19644474-19692421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19671607 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 313 (N313S)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
AA Change: N313S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: N313S

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19670952 missense probably damaging 1.00
IGL03095:Trim55 APN 3 19674465 missense probably benign 0.00
IGL03411:Trim55 APN 3 19659190 missense probably damaging 0.99
R0011:Trim55 UTSW 3 19670999 missense probably benign 0.00
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0194:Trim55 UTSW 3 19661861 missense probably benign 0.00
R0437:Trim55 UTSW 3 19670978 missense probably benign
R0450:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19644742 missense probably damaging 1.00
R1397:Trim55 UTSW 3 19644637 missense probably benign 0.01
R1928:Trim55 UTSW 3 19661882 critical splice donor site probably null
R2079:Trim55 UTSW 3 19644666 missense probably damaging 0.98
R3856:Trim55 UTSW 3 19672956 missense probably benign
R4646:Trim55 UTSW 3 19671122 missense probably benign 0.03
R4907:Trim55 UTSW 3 19674374 missense probably benign
R5562:Trim55 UTSW 3 19659153 missense probably benign 0.04
R6370:Trim55 UTSW 3 19691486 missense possibly damaging 0.87
R6658:Trim55 UTSW 3 19691555 missense probably damaging 1.00
R6786:Trim55 UTSW 3 19672774 missense probably benign
R8147:Trim55 UTSW 3 19672847 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTGCTTTCACAGAATGCCAAGAC -3'
(R):5'- TAAGACTGAGGGTCACGCTG -3'

Sequencing Primer
(F):5'- CCCTGTTGCAAAAGTGAGTAC -3'
(R):5'- TCACGCTGGTTTGTGATCC -3'
Posted On2016-06-06