Incidental Mutation 'R5090:Rbm5'
ID387701
Institutional Source Beutler Lab
Gene Symbol Rbm5
Ensembl Gene ENSMUSG00000032580
Gene NameRNA binding motif protein 5
SynonymsD030069N10Rik
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107740371-107770996 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 107760312 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035199] [ENSMUST00000182022] [ENSMUST00000182304] [ENSMUST00000182371] [ENSMUST00000182421] [ENSMUST00000182659] [ENSMUST00000183248] [ENSMUST00000192130]
Predicted Effect probably benign
Transcript: ENSMUST00000035199
SMART Domains Protein: ENSMUSP00000035199
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182007
Predicted Effect probably benign
Transcript: ENSMUST00000182022
SMART Domains Protein: ENSMUSP00000138390
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 137 2e-3 SMART
Blast:RRM 99 137 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182073
Predicted Effect probably benign
Transcript: ENSMUST00000182304
SMART Domains Protein: ENSMUSP00000138380
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
PDB:2LKZ|A 231 251 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182371
SMART Domains Protein: ENSMUSP00000138119
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182421
SMART Domains Protein: ENSMUSP00000138778
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182659
SMART Domains Protein: ENSMUSP00000138379
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183248
SMART Domains Protein: ENSMUSP00000138294
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183307
Predicted Effect probably benign
Transcript: ENSMUST00000192130
SMART Domains Protein: ENSMUSP00000142194
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194801
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility with azoospermia, male germ cell apoptosis, round spermatid arrest and spermatid differentiation arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Rbm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Rbm5 APN 9 107755846 unclassified probably benign
IGL02319:Rbm5 APN 9 107743865 nonsense probably null
IGL02567:Rbm5 APN 9 107744274 missense probably damaging 1.00
IGL02868:Rbm5 APN 9 107749700 splice site probably benign
IGL02943:Rbm5 APN 9 107744343 missense probably damaging 1.00
IGL02959:Rbm5 APN 9 107754185 unclassified probably benign
IGL03029:Rbm5 APN 9 107754453 missense possibly damaging 0.46
PIT4403001:Rbm5 UTSW 9 107760336 missense probably damaging 1.00
R0001:Rbm5 UTSW 9 107742424 missense probably damaging 1.00
R0242:Rbm5 UTSW 9 107751708 splice site probably benign
R1170:Rbm5 UTSW 9 107742497 missense probably damaging 0.99
R1239:Rbm5 UTSW 9 107752966 unclassified probably benign
R1297:Rbm5 UTSW 9 107744242 missense probably damaging 1.00
R1719:Rbm5 UTSW 9 107743913 critical splice acceptor site probably null
R1764:Rbm5 UTSW 9 107767564 nonsense probably null
R1826:Rbm5 UTSW 9 107742414 missense probably damaging 0.98
R1863:Rbm5 UTSW 9 107750519 missense possibly damaging 0.70
R4112:Rbm5 UTSW 9 107765597 missense probably damaging 1.00
R4207:Rbm5 UTSW 9 107750483 missense probably benign
R4343:Rbm5 UTSW 9 107752196 missense probably damaging 1.00
R4441:Rbm5 UTSW 9 107749688 intron probably benign
R4621:Rbm5 UTSW 9 107754146 missense probably damaging 1.00
R4767:Rbm5 UTSW 9 107745213 missense probably damaging 1.00
R5404:Rbm5 UTSW 9 107765553 missense probably damaging 1.00
R5876:Rbm5 UTSW 9 107760326 missense probably damaging 1.00
R5959:Rbm5 UTSW 9 107752140 missense probably benign 0.02
R5983:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R5984:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R7436:Rbm5 UTSW 9 107750394 intron probably null
R7447:Rbm5 UTSW 9 107746179 missense probably damaging 1.00
R7867:Rbm5 UTSW 9 107751731 missense probably benign 0.02
R7950:Rbm5 UTSW 9 107751731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAACAGTCAAACAAGGAGTTC -3'
(R):5'- CCACGAGGTTAAGGGTTTAGTC -3'

Sequencing Primer
(F):5'- GGAGTTCATAAATCACTACTTACCG -3'
(R):5'- GTATAGCCCACTTTGTAGACCAGG -3'
Posted On2016-06-06