Incidental Mutation 'R5090:Hmgcr'
ID387712
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A reductase
SynonymsHMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96648967-96670936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96650590 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 162 (K162E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169202] [ENSMUST00000170287]
Predicted Effect probably benign
Transcript: ENSMUST00000022176
AA Change: K885E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: K885E

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect probably benign
Transcript: ENSMUST00000169202
SMART Domains Protein: ENSMUSP00000132155
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 35 219 8.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169945
AA Change: K162E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128642
Gene: ENSMUSG00000021670
AA Change: K162E

DomainStartEndE-ValueType
Pfam:HMG-CoA_red 1 96 1.8e-37 PFAM
Pfam:HMG-CoA_red 96 148 2.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170287
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Grap2 A C 15: 80,638,482 N70H possibly damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96659278 missense probably benign
IGL01369:Hmgcr APN 13 96666522 missense probably null 1.00
IGL01575:Hmgcr APN 13 96656595 missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96663127 missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96666512 splice site probably benign
IGL02716:Hmgcr APN 13 96660012 critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96656762 splice site probably benign
IGL03367:Hmgcr APN 13 96665853 missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96659054 missense probably damaging 1.00
PIT4504001:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
R0003:Hmgcr UTSW 13 96652145 missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0217:Hmgcr UTSW 13 96651980 missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96660143 unclassified probably null
R0707:Hmgcr UTSW 13 96650643 unclassified probably benign
R1301:Hmgcr UTSW 13 96659020 missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96665885 missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96663068 missense probably damaging 0.99
R3159:Hmgcr UTSW 13 96665847 missense probably damaging 1.00
R3737:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96663116 missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3838:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3839:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R4034:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96660221 missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96666193 missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96660192 missense probably damaging 1.00
R5113:Hmgcr UTSW 13 96656732 missense probably benign 0.00
R5209:Hmgcr UTSW 13 96666512 splice site probably benign
R5354:Hmgcr UTSW 13 96654896 missense probably benign 0.26
R5571:Hmgcr UTSW 13 96666663 missense probably benign 0.11
R5804:Hmgcr UTSW 13 96666187 missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96660183 missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96665858 missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96658982 missense probably benign
R6699:Hmgcr UTSW 13 96660209 missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96658910 missense probably benign 0.10
R7061:Hmgcr UTSW 13 96666148 missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96652665 missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96666597 missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96656723 missense probably benign 0.01
R7709:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGCAAAGAACCTCAGACGTC -3'
(R):5'- CTGGTCTGGGAATTACCACTAAAATG -3'

Sequencing Primer
(F):5'- AGACGTCTCTGAAAGCGC -3'
(R):5'- ACTTGGCAAGTTCCAGGCTACTG -3'
Posted On2016-06-06