Mutagenetix > Incidental Mutation

Incidental Mutation 'R5090:Map1b'

387713

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

042679-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5090 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 99430026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2062 (Y2062*)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

probably null
Transcript: ENSMUST00000064762
AA Change: Y2062*

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: Y2062*

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.9709

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.2%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	G	7: 120,385,199	S1168G	probably damaging	Het
Acsf2	A	T	11: 94,571,269		probably null	Het
AI481877	T	C	4: 59,111,108	T55A	unknown	Het
Ankk1	G	T	9: 49,421,763	S140R	probably damaging	Het
Ash1l	G	T	3: 89,052,877	K2305N	probably damaging	Het
Asnsd1	C	T	1: 53,352,404		probably benign	Het
Atxn7l1	T	C	12: 33,326,078	S51P	probably damaging	Het
Ccdc88c	A	G	12: 100,954,180	L394P	probably damaging	Het
Cd200r1	T	A	16: 44,789,561	S48T	possibly damaging	Het
Cemip	T	C	7: 83,942,135	E1243G	probably damaging	Het
Cep192	T	A	18: 67,860,546	H1977Q	possibly damaging	Het
Cep250	T	C	2: 155,976,404	L833P	probably damaging	Het
Chd9	C	A	8: 91,026,834	Y1818*	probably null	Het
Clca3a1	C	A	3: 144,737,872	V706L	probably benign	Het
Cntln	T	C	4: 84,947,593	V162A	probably damaging	Het
Col5a1	G	A	2: 28,018,602	W67*	probably null	Het
Cux1	T	A	5: 136,313,200	N446I	possibly damaging	Het
Dlg1	G	T	16: 31,838,084	G599W	probably damaging	Het
Dock7	C	T	4: 98,991,411	V969I	probably benign	Het
Ephb3	T	C	16: 21,214,487	C74R	probably damaging	Het
Fads6	T	A	11: 115,296,654	T72S	probably benign	Het
Fra10ac1	C	T	19: 38,214,425	R110Q	probably damaging	Het
Gdf3	T	A	6: 122,609,754	L71F	probably benign	Het
Gm1966	T	A	7: 106,600,902		noncoding transcript	Het
Gm6685	A	G	11: 28,339,253	Y188H	probably benign	Het
Gm6981	A	C	9: 52,002,842		noncoding transcript	Het
Gnpda1	T	C	18: 38,332,093	T157A	probably damaging	Het
Grap2	A	C	15: 80,638,482	N70H	possibly damaging	Het
Hdac5	G	A	11: 102,197,713	R887C	probably damaging	Het
Hectd3	T	A	4: 117,000,238		probably benign	Het
Hmgcr	T	C	13: 96,650,590	K162E	probably benign	Het
Inpp5e	A	T	2: 26,399,371		probably null	Het
Kifap3	A	G	1: 163,856,076	D442G	possibly damaging	Het
Lama3	A	G	18: 12,542,402	T1015A	possibly damaging	Het
Lcp2	T	A	11: 34,089,725	Y508*	probably null	Het
Mipep	A	G	14: 60,802,299	D259G	possibly damaging	Het
Mmp2	T	C	8: 92,852,574	F97S	probably damaging	Het
Mrpl18	A	C	17: 12,913,810	M144R	probably damaging	Het
Nek9	A	G	12: 85,329,842		probably null	Het
Nmral1	A	T	16: 4,714,531	Y139N	probably damaging	Het
Notch4	T	C	17: 34,580,920	C952R	probably damaging	Het
Nsf	T	C	11: 103,910,578	N204D	probably benign	Het
P2rx4	A	T	5: 122,725,055	D197V	probably damaging	Het
Pak7	A	T	2: 136,087,418	I615N	probably damaging	Het
Parp10	T	C	15: 76,241,725	D421G	probably damaging	Het
Pcdha6	A	T	18: 36,968,717	D321V	probably benign	Het
Pkhd1	T	A	1: 20,200,757	I3191F	probably damaging	Het
Psmd4	T	C	3: 95,035,248	N7S	possibly damaging	Het
Ptprq	A	G	10: 107,526,089	V2084A	probably damaging	Het
Rab3gap1	A	G	1: 127,915,678	E263G	probably benign	Het
Rbm5	A	G	9: 107,760,312		probably benign	Het
Sacs	T	C	14: 61,205,253	F1583L	probably damaging	Het
Sel1l3	G	T	5: 53,200,046	H201Q	probably benign	Het
Tdpoz3	T	A	3: 93,826,563	W182R	possibly damaging	Het
Trim55	A	G	3: 19,671,607	N313S	probably benign	Het
Usp17lb	A	T	7: 104,841,083	D212E	probably benign	Het
Xirp2	A	G	2: 67,525,470	E3525G	possibly damaging	Het
Zfp236	T	C	18: 82,618,881	T1379A	probably benign	Het
Zfp553	A	T	7: 127,235,487	E71D	probably damaging	Het
Znrf1	T	G	8: 111,538,403	F21V	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GGGGAACATCAGAGTCTGTC -3'
(R):5'- TTGGCGACTGTAGCTACTCC -3'

Sequencing Primer
(F):5'- ATGGGGCTGACTCACTGACTG -3'
(R):5'- GGCGACTGTAGCTACTCCTATGAAAC -3'

Posted On

2016-06-06