Incidental Mutation 'R5090:Grap2'
ID387717
Institutional Source Beutler Lab
Gene Symbol Grap2
Ensembl Gene ENSMUSG00000042351
Gene NameGRB2-related adaptor protein 2
SynonymsMona, Grb2-related adaptor downstream of Sch, GRAP-2, GrbX, GRB2L, Grf40, GRID, P38, Gads, GrpL
MMRRC Submission 042679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5090 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80572594-80652854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80638482 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 70 (N70H)
Ref Sequence ENSEMBL: ENSMUSP00000155681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043149] [ENSMUST00000229980] [ENSMUST00000230573] [ENSMUST00000230856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043149
AA Change: N70H

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046532
Gene: ENSMUSG00000042351
AA Change: N70H

DomainStartEndE-ValueType
SH3 1 55 3.48e-16 SMART
SH2 56 138 7.49e-32 SMART
low complexity region 193 216 N/A INTRINSIC
SH3 266 321 4.31e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229980
AA Change: N70H

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000230573
Predicted Effect probably benign
Transcript: ENSMUST00000230856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230939
Meta Mutation Damage Score 0.1039 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly healthy but display abnormal T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,385,199 S1168G probably damaging Het
Acsf2 A T 11: 94,571,269 probably null Het
AI481877 T C 4: 59,111,108 T55A unknown Het
Ankk1 G T 9: 49,421,763 S140R probably damaging Het
Ash1l G T 3: 89,052,877 K2305N probably damaging Het
Asnsd1 C T 1: 53,352,404 probably benign Het
Atxn7l1 T C 12: 33,326,078 S51P probably damaging Het
Ccdc88c A G 12: 100,954,180 L394P probably damaging Het
Cd200r1 T A 16: 44,789,561 S48T possibly damaging Het
Cemip T C 7: 83,942,135 E1243G probably damaging Het
Cep192 T A 18: 67,860,546 H1977Q possibly damaging Het
Cep250 T C 2: 155,976,404 L833P probably damaging Het
Chd9 C A 8: 91,026,834 Y1818* probably null Het
Clca3a1 C A 3: 144,737,872 V706L probably benign Het
Cntln T C 4: 84,947,593 V162A probably damaging Het
Col5a1 G A 2: 28,018,602 W67* probably null Het
Cux1 T A 5: 136,313,200 N446I possibly damaging Het
Dlg1 G T 16: 31,838,084 G599W probably damaging Het
Dock7 C T 4: 98,991,411 V969I probably benign Het
Ephb3 T C 16: 21,214,487 C74R probably damaging Het
Fads6 T A 11: 115,296,654 T72S probably benign Het
Fra10ac1 C T 19: 38,214,425 R110Q probably damaging Het
Gdf3 T A 6: 122,609,754 L71F probably benign Het
Gm1966 T A 7: 106,600,902 noncoding transcript Het
Gm6685 A G 11: 28,339,253 Y188H probably benign Het
Gm6981 A C 9: 52,002,842 noncoding transcript Het
Gnpda1 T C 18: 38,332,093 T157A probably damaging Het
Hdac5 G A 11: 102,197,713 R887C probably damaging Het
Hectd3 T A 4: 117,000,238 probably benign Het
Hmgcr T C 13: 96,650,590 K162E probably benign Het
Inpp5e A T 2: 26,399,371 probably null Het
Kifap3 A G 1: 163,856,076 D442G possibly damaging Het
Lama3 A G 18: 12,542,402 T1015A possibly damaging Het
Lcp2 T A 11: 34,089,725 Y508* probably null Het
Map1b G T 13: 99,430,026 Y2062* probably null Het
Mipep A G 14: 60,802,299 D259G possibly damaging Het
Mmp2 T C 8: 92,852,574 F97S probably damaging Het
Mrpl18 A C 17: 12,913,810 M144R probably damaging Het
Nek9 A G 12: 85,329,842 probably null Het
Nmral1 A T 16: 4,714,531 Y139N probably damaging Het
Notch4 T C 17: 34,580,920 C952R probably damaging Het
Nsf T C 11: 103,910,578 N204D probably benign Het
P2rx4 A T 5: 122,725,055 D197V probably damaging Het
Pak7 A T 2: 136,087,418 I615N probably damaging Het
Parp10 T C 15: 76,241,725 D421G probably damaging Het
Pcdha6 A T 18: 36,968,717 D321V probably benign Het
Pkhd1 T A 1: 20,200,757 I3191F probably damaging Het
Psmd4 T C 3: 95,035,248 N7S possibly damaging Het
Ptprq A G 10: 107,526,089 V2084A probably damaging Het
Rab3gap1 A G 1: 127,915,678 E263G probably benign Het
Rbm5 A G 9: 107,760,312 probably benign Het
Sacs T C 14: 61,205,253 F1583L probably damaging Het
Sel1l3 G T 5: 53,200,046 H201Q probably benign Het
Tdpoz3 T A 3: 93,826,563 W182R possibly damaging Het
Trim55 A G 3: 19,671,607 N313S probably benign Het
Usp17lb A T 7: 104,841,083 D212E probably benign Het
Xirp2 A G 2: 67,525,470 E3525G possibly damaging Het
Zfp236 T C 18: 82,618,881 T1379A probably benign Het
Zfp553 A T 7: 127,235,487 E71D probably damaging Het
Znrf1 T G 8: 111,538,403 F21V probably benign Het
Other mutations in Grap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Grap2 APN 15 80634409 missense probably damaging 1.00
IGL02121:Grap2 APN 15 80647875 missense possibly damaging 0.77
IGL02347:Grap2 APN 15 80646356 splice site probably benign
IGL02561:Grap2 APN 15 80647848 splice site probably benign
Aquavit UTSW 15 80643673 missense probably damaging 0.97
Grappa UTSW 15 80648522 missense probably damaging 0.98
R1465:Grap2 UTSW 15 80648411 splice site probably null
R1465:Grap2 UTSW 15 80648411 splice site probably null
R1591:Grap2 UTSW 15 80648448 missense probably damaging 1.00
R2050:Grap2 UTSW 15 80646243 missense probably benign 0.09
R2862:Grap2 UTSW 15 80647964 missense probably damaging 0.98
R3801:Grap2 UTSW 15 80623746 missense possibly damaging 0.62
R3804:Grap2 UTSW 15 80623746 missense possibly damaging 0.62
R4838:Grap2 UTSW 15 80638561 missense possibly damaging 0.92
R5119:Grap2 UTSW 15 80646144 missense possibly damaging 0.93
R5121:Grap2 UTSW 15 80646144 missense possibly damaging 0.93
R6652:Grap2 UTSW 15 80648522 missense probably damaging 0.98
R6873:Grap2 UTSW 15 80643673 missense probably damaging 0.97
R7082:Grap2 UTSW 15 80648498 missense probably benign 0.27
R7512:Grap2 UTSW 15 80648553 missense probably benign 0.08
R7571:Grap2 UTSW 15 80643704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAATGCATGCCCCAAACC -3'
(R):5'- CAGGTCATTTTGAACAGAAATCAGG -3'

Sequencing Primer
(F):5'- CCTGACTCACCGTCCCTGG -3'
(R):5'- CATGTTCTGGGGAAGAAATAGTCC -3'
Posted On2016-06-06