Mutagenetix > Incidental Mutations

Incidental Mutation 'R5091:Slc13a3'

387737

Institutional Source

Beutler Lab

Gene Symbol

Slc13a3

Ensembl Gene

ENSMUSG00000018459

Gene Name

solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3

Synonyms

SDCT2, NaDC-3, NaDC3

MMRRC Submission

042680-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

165405028-165473230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 165420080 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 369 (E369G)

Ref Sequence

ENSEMBL: ENSMUSP00000104902 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]

Predicted Effect

probably benign
Transcript: ENSMUST00000029208
AA Change: E411G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: E411G

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	9	571	2.6e-110	PFAM
Pfam:CitMHS	43	167	1.4e-15	PFAM
Pfam:CitMHS	221	486	5.3e-18	PFAM
low complexity region	578	596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109279
AA Change: E369G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459
AA Change: E369G

Domain	Start	End	E-Value	Type
Pfam:Na_sulph_symp	9	270	6.7e-49	PFAM
Pfam:Na_sulph_symp	265	529	1.9e-51	PFAM
low complexity region	536	554	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143136

Meta Mutation Damage Score

0.0991

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	G	13: 54,553,244	S174P	probably damaging	Het
4931414P19Rik	T	C	14: 54,585,711	E343G	probably damaging	Het
9530053A07Rik	A	C	7: 28,156,958	I2057L	probably benign	Het
Abca14	T	C	7: 120,252,274	V825A	probably damaging	Het
Abca8b	G	T	11: 109,936,384	T1466K	possibly damaging	Het
Adcy8	A	G	15: 64,806,704	S467P	probably damaging	Het
Agbl4	T	C	4: 111,119,040	V198A	possibly damaging	Het
Agpat4	A	G	17: 12,198,812	K80R	probably benign	Het
Akap8	T	C	17: 32,316,234	T269A	probably benign	Het
Ankhd1	A	T	18: 36,625,027	I925F	possibly damaging	Het
Aste1	A	G	9: 105,405,004	Y57C	probably damaging	Het
Axdnd1	A	G	1: 156,420,410	S7P	possibly damaging	Het
BC051019	T	A	7: 109,720,582	R91S	probably null	Het
Cavin2	C	A	1: 51,301,239	N358K	probably benign	Het
Cd2	T	C	3: 101,283,039	N196S	probably benign	Het
Clca3a1	C	T	3: 144,730,722	V867I	probably benign	Het
Col6a4	T	A	9: 106,075,063	K545N	probably damaging	Het
Cps1	T	A	1: 67,229,520		probably null	Het
Cyp2c65	A	T	19: 39,087,565		probably null	Het
Dcaf6	T	C	1: 165,330,003	D856G	possibly damaging	Het
E130309D02Rik	C	T	5: 143,307,688	E345K	possibly damaging	Het
Epcam	T	C	17: 87,642,152	I181T	probably damaging	Het
Esrp2	A	G	8: 106,132,429	S562P	probably damaging	Het
Ffar4	A	G	19: 38,097,179	D18G	probably benign	Het
Gen1	C	T	12: 11,246,346	V337I	probably damaging	Het
Gimap8	C	T	6: 48,656,647	P467S	possibly damaging	Het
Gnl3	T	A	14: 31,016,846	H82L	possibly damaging	Het
Grid2	T	C	6: 64,076,878	S354P	probably benign	Het
Ighmbp2	T	A	19: 3,265,084	T779S	possibly damaging	Het
Kif19a	C	A	11: 114,783,097	T348N	probably damaging	Het
Lrrc15	T	A	16: 30,273,354	N389I	probably damaging	Het
Mrps26	A	G	2: 130,563,966	Y63C	probably damaging	Het
Myd88	C	A	9: 119,337,823	V223F	possibly damaging	Het
Nox4	T	A	7: 87,376,242	W526R	probably damaging	Het
Nrg2	A	T	18: 36,052,785	N300K	probably damaging	Het
Nsmf	T	C	2: 25,060,452		probably benign	Het
Patl2	A	C	2: 122,123,802	H429Q	probably benign	Het
Pcdhb12	A	T	18: 37,435,854	K18*	probably null	Het
Peg10	T	A	6: 4,754,511	D97E	probably benign	Het
Runx1t1	C	T	4: 13,846,830	Q205*	probably null	Het
Selenon	T	C	4: 134,547,973	K138R	probably damaging	Het
Sorcs1	A	G	19: 50,259,752		probably null	Het
Sptbn4	A	T	7: 27,369,391	M499K	probably damaging	Het
Sra1	A	T	18: 36,669,959		probably benign	Het
Stra6	T	C	9: 58,141,146	L174P	probably damaging	Het
Syngr1	T	C	15: 80,115,885	Y66H	probably damaging	Het
Synpo	G	T	18: 60,602,759	S466*	probably null	Het
Tenm3	T	A	8: 48,342,308	M595L	probably benign	Het
Tnks	T	C	8: 34,841,809	T1099A	probably benign	Het
Tram1l1	G	T	3: 124,321,751	V187F	possibly damaging	Het
Trappc11	T	C	8: 47,512,604	E529G	probably benign	Het
Usp17la	T	C	7: 104,860,932	V248A	probably damaging	Het
Virma	T	C	4: 11,519,392	Y880H	probably benign	Het
Vmn1r214	C	T	13: 23,035,401	T355I	possibly damaging	Het
Vmn2r7	T	C	3: 64,690,784	K784R	possibly damaging	Het
Wrap53	C	T	11: 69,562,447	W389*	probably null	Het
Zfp748	A	G	13: 67,541,519	S541P	probably damaging	Het

Other mutations in Slc13a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Slc13a3	APN	2	165411923	missense	probably damaging	1.00
IGL00326:Slc13a3	APN	2	165473097	missense	possibly damaging	0.89
IGL01308:Slc13a3	APN	2	165406780	missense	probably damaging	0.99
IGL01668:Slc13a3	APN	2	165430292	missense	probably damaging	1.00
IGL02435:Slc13a3	APN	2	165408940	missense	possibly damaging	0.95
IGL02551:Slc13a3	APN	2	165424573	missense	probably damaging	1.00
IGL02716:Slc13a3	APN	2	165406715	missense	unknown
IGL03107:Slc13a3	APN	2	165437307	missense	probably benign	0.00
R0114:Slc13a3	UTSW	2	165424581	missense	probably damaging	1.00
R0624:Slc13a3	UTSW	2	165411887	missense	probably damaging	1.00
R1051:Slc13a3	UTSW	2	165408820	critical splice donor site	probably null
R1780:Slc13a3	UTSW	2	165406699	missense	unknown
R1782:Slc13a3	UTSW	2	165445519	missense	probably benign	0.01
R1994:Slc13a3	UTSW	2	165434064	missense	possibly damaging	0.90
R4739:Slc13a3	UTSW	2	165430289	missense	possibly damaging	0.91
R4971:Slc13a3	UTSW	2	165448699	missense	probably damaging	0.99
R5093:Slc13a3	UTSW	2	165411896	missense	probably damaging	1.00
R5826:Slc13a3	UTSW	2	165408956	missense	probably benign	0.05
R5894:Slc13a3	UTSW	2	165424623	missense	probably benign	0.00
R6239:Slc13a3	UTSW	2	165406697	missense	unknown
R6394:Slc13a3	UTSW	2	165434097	missense	probably damaging	1.00
R6453:Slc13a3	UTSW	2	165411947	missense	possibly damaging	0.94
R6463:Slc13a3	UTSW	2	165445653	missense	probably damaging	1.00
R6480:Slc13a3	UTSW	2	165408898	missense	probably damaging	1.00
R6525:Slc13a3	UTSW	2	165406747	missense	unknown
R6879:Slc13a3	UTSW	2	165430301	missense	probably damaging	1.00
R7278:Slc13a3	UTSW	2	165445528	missense	possibly damaging	0.87
R7340:Slc13a3	UTSW	2	165430290	missense	probably benign	0.00
R7404:Slc13a3	UTSW	2	165434064	missense	possibly damaging	0.90
R7452:Slc13a3	UTSW	2	165427114	missense	probably benign	0.03
R7585:Slc13a3	UTSW	2	165430322	missense	probably benign	0.00
R7966:Slc13a3	UTSW	2	165430235	missense	probably benign	0.08
R8206:Slc13a3	UTSW	2	165406825	missense	probably damaging	1.00
R8481:Slc13a3	UTSW	2	165434038	missense	probably damaging	0.99
R8504:Slc13a3	UTSW	2	165434079	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTCACCTCACAGCCTGGAC -3'
(R):5'- TTCTGATCAGAATGAGGAGCTAAGG -3'

Sequencing Primer
(F):5'- TGGCCAGAGCTTCCACTC -3'
(R):5'- GCTAAGGCTCTCCCTAAATCC -3'

Posted On

2016-06-06