Incidental Mutation 'R5091:Vmn2r7'
ID387738
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5091 (G1)
Quality Score81
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64690784 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 784 (K784R)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161972
AA Change: K875R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: K875R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168072
AA Change: K784R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: K784R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R7947:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTACCCATGAGCATCCGC -3'
(R):5'- ATGTATCACTTTTGGAATGCTGGTC -3'

Sequencing Primer
(F):5'- CGCAGCTGCTTGAAAAACAATGTTC -3'
(R):5'- CACTTTTGGAATGCTGGTCTTTTTC -3'
Posted On2016-06-06