Mutagenetix > Incidental Mutations

Incidental Mutation 'R5091:Tnks'

387756

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

042680-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34841809 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1099 (T1099A)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000033929
AA Change: T1099A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: T1099A

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209904

Predicted Effect

probably benign
Transcript: ENSMUST00000210014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210870

Meta Mutation Damage Score

0.2019

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (67/70)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	G	13: 54,553,244	S174P	probably damaging	Het
4931414P19Rik	T	C	14: 54,585,711	E343G	probably damaging	Het
9530053A07Rik	A	C	7: 28,156,958	I2057L	probably benign	Het
Abca14	T	C	7: 120,252,274	V825A	probably damaging	Het
Abca8b	G	T	11: 109,936,384	T1466K	possibly damaging	Het
Adcy8	A	G	15: 64,806,704	S467P	probably damaging	Het
Agbl4	T	C	4: 111,119,040	V198A	possibly damaging	Het
Agpat4	A	G	17: 12,198,812	K80R	probably benign	Het
Akap8	T	C	17: 32,316,234	T269A	probably benign	Het
Ankhd1	A	T	18: 36,625,027	I925F	possibly damaging	Het
Aste1	A	G	9: 105,405,004	Y57C	probably damaging	Het
Axdnd1	A	G	1: 156,420,410	S7P	possibly damaging	Het
BC051019	T	A	7: 109,720,582	R91S	probably null	Het
Cavin2	C	A	1: 51,301,239	N358K	probably benign	Het
Cd2	T	C	3: 101,283,039	N196S	probably benign	Het
Clca3a1	C	T	3: 144,730,722	V867I	probably benign	Het
Col6a4	T	A	9: 106,075,063	K545N	probably damaging	Het
Cps1	T	A	1: 67,229,520		probably null	Het
Cyp2c65	A	T	19: 39,087,565		probably null	Het
Dcaf6	T	C	1: 165,330,003	D856G	possibly damaging	Het
E130309D02Rik	C	T	5: 143,307,688	E345K	possibly damaging	Het
Epcam	T	C	17: 87,642,152	I181T	probably damaging	Het
Esrp2	A	G	8: 106,132,429	S562P	probably damaging	Het
Ffar4	A	G	19: 38,097,179	D18G	probably benign	Het
Gen1	C	T	12: 11,246,346	V337I	probably damaging	Het
Gimap8	C	T	6: 48,656,647	P467S	possibly damaging	Het
Gnl3	T	A	14: 31,016,846	H82L	possibly damaging	Het
Grid2	T	C	6: 64,076,878	S354P	probably benign	Het
Ighmbp2	T	A	19: 3,265,084	T779S	possibly damaging	Het
Kif19a	C	A	11: 114,783,097	T348N	probably damaging	Het
Lrrc15	T	A	16: 30,273,354	N389I	probably damaging	Het
Mrps26	A	G	2: 130,563,966	Y63C	probably damaging	Het
Myd88	C	A	9: 119,337,823	V223F	possibly damaging	Het
Nox4	T	A	7: 87,376,242	W526R	probably damaging	Het
Nrg2	A	T	18: 36,052,785	N300K	probably damaging	Het
Nsmf	T	C	2: 25,060,452		probably benign	Het
Patl2	A	C	2: 122,123,802	H429Q	probably benign	Het
Pcdhb12	A	T	18: 37,435,854	K18*	probably null	Het
Peg10	T	A	6: 4,754,511	D97E	probably benign	Het
Runx1t1	C	T	4: 13,846,830	Q205*	probably null	Het
Selenon	T	C	4: 134,547,973	K138R	probably damaging	Het
Slc13a3	T	C	2: 165,420,080	E369G	probably benign	Het
Sorcs1	A	G	19: 50,259,752		probably null	Het
Sptbn4	A	T	7: 27,369,391	M499K	probably damaging	Het
Sra1	A	T	18: 36,669,959		probably benign	Het
Stra6	T	C	9: 58,141,146	L174P	probably damaging	Het
Syngr1	T	C	15: 80,115,885	Y66H	probably damaging	Het
Synpo	G	T	18: 60,602,759	S466*	probably null	Het
Tenm3	T	A	8: 48,342,308	M595L	probably benign	Het
Tram1l1	G	T	3: 124,321,751	V187F	possibly damaging	Het
Trappc11	T	C	8: 47,512,604	E529G	probably benign	Het
Usp17la	T	C	7: 104,860,932	V248A	probably damaging	Het
Virma	T	C	4: 11,519,392	Y880H	probably benign	Het
Vmn1r214	C	T	13: 23,035,401	T355I	possibly damaging	Het
Vmn2r7	T	C	3: 64,690,784	K784R	possibly damaging	Het
Wrap53	C	T	11: 69,562,447	W389*	probably null	Het
Zfp748	A	G	13: 67,541,519	S541P	probably damaging	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATTTAAAGGCTGGCTGCTGC -3'
(R):5'- GGAGAAGCCCCTTACCACTTTC -3'

Sequencing Primer
(F):5'- GCCTCCGGCTGAGTAGC -3'
(R):5'- GCCTTTGGTATATCTGCTTACAG -3'

Posted On

2016-06-06