Incidental Mutation 'R5091:Wrap53'
ID387765
Institutional Source Beutler Lab
Gene Symbol Wrap53
Ensembl Gene ENSMUSG00000041346
Gene NameWD repeat containing, antisense to Trp53
SynonymsWdr79
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69561758-69580255 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 69562447 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 389 (W389*)
Ref Sequence ENSEMBL: ENSMUSP00000047825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036] [ENSMUST00000048139]
Predicted Effect probably benign
Transcript: ENSMUST00000004036
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000048139
AA Change: W389*
SMART Domains Protein: ENSMUSP00000047825
Gene: ENSMUSG00000041346
AA Change: W389*

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
WD40 144 181 5.75e-1 SMART
Blast:WD40 197 242 3e-18 BLAST
WD40 245 288 1.67e-1 SMART
WD40 295 337 3.58e-1 SMART
WD40 340 380 1.19e-6 SMART
WD40 384 425 8.25e0 SMART
Blast:WD40 435 471 1e-14 BLAST
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155894
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the telomerase holoenzyme complex, a ribonucleoprotein complex required for telomere synthesis. This protein is enriched in Cajal bodies, nuclear sites of RNP processing that are important for telomerase function. It interacts with dyskerin, TERT and TERC, other components of active telomerase, and with small Cajal body RNAs (scaRNAs), which are involved in modifying splicing RNAs. This mRNA also functions as a p53 antisense transcript, that regulates endogenous p53 mRNA levels and further induction of p53 protein by targeting the 5' untranslated region of p53 mRNA. Alternatively spliced transcript variants which differ only in the 5' UTR have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Wrap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Wrap53 APN 11 69562740 missense possibly damaging 0.72
IGL02342:Wrap53 APN 11 69563591 missense probably damaging 0.99
P4748:Wrap53 UTSW 11 69562205 missense probably damaging 1.00
R0021:Wrap53 UTSW 11 69563886 missense probably damaging 0.99
R0060:Wrap53 UTSW 11 69563430 missense possibly damaging 0.88
R0682:Wrap53 UTSW 11 69562446 missense probably damaging 1.00
R1061:Wrap53 UTSW 11 69562400 missense probably damaging 1.00
R1708:Wrap53 UTSW 11 69563935 nonsense probably null
R1868:Wrap53 UTSW 11 69562164 missense probably null 0.46
R3113:Wrap53 UTSW 11 69563318 missense probably benign 0.31
R5119:Wrap53 UTSW 11 69563932 missense possibly damaging 0.84
R6263:Wrap53 UTSW 11 69562793 nonsense probably null
R6337:Wrap53 UTSW 11 69577685 missense probably benign 0.30
R6537:Wrap53 UTSW 11 69563868 missense possibly damaging 0.49
R6628:Wrap53 UTSW 11 69562144 missense probably benign 0.00
R7111:Wrap53 UTSW 11 69562479 missense probably damaging 1.00
R7138:Wrap53 UTSW 11 69563868 missense probably benign 0.32
R7431:Wrap53 UTSW 11 69578487 missense possibly damaging 0.88
X0063:Wrap53 UTSW 11 69578537 missense probably benign
Z1088:Wrap53 UTSW 11 69578498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGCAGACAGGCATGACC -3'
(R):5'- GCAATCTCTTCTTCTCGGGAGC -3'

Sequencing Primer
(F):5'- CCTTGGGGTAGAAGCCATTC -3'
(R):5'- CCCAAAGCATGTGGGTAGTC -3'
Posted On2016-06-06