Incidental Mutation 'R5091:Syngr1'
ID387775
Institutional Source Beutler Lab
Gene Symbol Syngr1
Ensembl Gene ENSMUSG00000022415
Gene Namesynaptogyrin 1
Synonymsp29, Syngr1b
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80091334-80119501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80115885 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 66 (Y66H)
Ref Sequence ENSEMBL: ENSMUSP00000121716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009727] [ENSMUST00000009728] [ENSMUST00000135727] [ENSMUST00000143928]
Predicted Effect probably damaging
Transcript: ENSMUST00000009727
AA Change: Y172H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009727
Gene: ENSMUSG00000022415
AA Change: Y172H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000009728
SMART Domains Protein: ENSMUSP00000009728
Gene: ENSMUSG00000022415

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:MARVEL 20 167 1.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135727
AA Change: Y66H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000143928
SMART Domains Protein: ENSMUSP00000120696
Gene: ENSMUSG00000022415

DomainStartEndE-ValueType
Pfam:MARVEL 4 111 1.2e-24 PFAM
Meta Mutation Damage Score 0.3898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein associated with presynaptic vesicles in neuronal cells. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it functions in synaptic plasticity without being required for synaptic transmission. The gene product belongs to the synaptogyrin gene family. Three alternatively spliced variants encoding three different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a moderate decrease in post-tetanic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Syngr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2092:Syngr1 UTSW 15 80115940 missense possibly damaging 0.93
R2508:Syngr1 UTSW 15 80111740 missense probably damaging 1.00
R3887:Syngr1 UTSW 15 80116039 missense probably damaging 0.99
R5255:Syngr1 UTSW 15 80091446 missense possibly damaging 0.78
R5271:Syngr1 UTSW 15 80098039 missense probably benign 0.01
R5440:Syngr1 UTSW 15 80098018 missense probably benign
R6369:Syngr1 UTSW 15 80115590 unclassified probably benign
R6596:Syngr1 UTSW 15 80111692 missense probably damaging 0.98
R7216:Syngr1 UTSW 15 80111733 missense probably damaging 1.00
R7834:Syngr1 UTSW 15 80111617 missense probably damaging 1.00
R8395:Syngr1 UTSW 15 80113244 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTGATAGATGGCTGATACG -3'
(R):5'- TGAGGCTCAGCATCAAAGGC -3'

Sequencing Primer
(F):5'- ATAGATGGCTGATACGGTCCC -3'
(R):5'- CTCAGCATCAAAGGCGTTGG -3'
Posted On2016-06-06