Incidental Mutation 'R5091:Lrrc15'
ID387776
Institutional Source Beutler Lab
Gene Symbol Lrrc15
Ensembl Gene ENSMUSG00000052316
Gene Nameleucine rich repeat containing 15
Synonyms5430427N11Rik
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30269302-30283256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30273354 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 389 (N389I)
Ref Sequence ENSEMBL: ENSMUSP00000066777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064606]
Predicted Effect probably damaging
Transcript: ENSMUST00000064606
AA Change: N389I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066777
Gene: ENSMUSG00000052316
AA Change: N389I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 24 57 2.98e0 SMART
LRR 76 99 6.97e1 SMART
LRR_TYP 100 123 1.98e-4 SMART
LRR 124 147 4.08e0 SMART
LRR_TYP 148 171 2.4e-3 SMART
LRR_TYP 172 195 1.82e-3 SMART
LRR_TYP 196 219 1.18e-2 SMART
LRR_TYP 220 243 3.16e-3 SMART
LRR_TYP 245 267 3.39e-3 SMART
LRR_TYP 268 291 8.81e-2 SMART
LRR_TYP 292 315 9.5e-7 SMART
LRR_TYP 316 339 6.52e-5 SMART
LRR_TYP 340 363 7.78e-3 SMART
LRR_TYP 364 387 1.03e-2 SMART
LRR 388 411 8.48e0 SMART
LRRCT 423 474 1.11e-3 SMART
low complexity region 485 512 N/A INTRINSIC
transmembrane domain 537 559 N/A INTRINSIC
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Lrrc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Lrrc15 APN 16 30274030 missense possibly damaging 0.90
IGL01720:Lrrc15 APN 16 30273320 missense probably benign 0.19
R0138:Lrrc15 UTSW 16 30273449 missense possibly damaging 0.63
R0317:Lrrc15 UTSW 16 30273743 missense probably benign
R0497:Lrrc15 UTSW 16 30272892 missense probably damaging 0.98
R0528:Lrrc15 UTSW 16 30273748 missense probably damaging 0.99
R1122:Lrrc15 UTSW 16 30273901 missense probably damaging 1.00
R1950:Lrrc15 UTSW 16 30273831 missense probably benign 0.21
R2898:Lrrc15 UTSW 16 30273786 missense probably benign 0.01
R4272:Lrrc15 UTSW 16 30273855 missense probably benign 0.06
R4839:Lrrc15 UTSW 16 30274268 missense probably benign 0.00
R5369:Lrrc15 UTSW 16 30272904 missense possibly damaging 0.93
R6076:Lrrc15 UTSW 16 30272988 missense probably benign 0.25
R6133:Lrrc15 UTSW 16 30274236 missense probably benign 0.11
R7017:Lrrc15 UTSW 16 30272962 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAGTGTCTGTCCCCAAC -3'
(R):5'- CCAGTTGCAGGTTCTGATTCTTAG -3'

Sequencing Primer
(F):5'- CCAACCTGGCTCTGTTGAGAATG -3'
(R):5'- GCAGGTTCTGATTCTTAGTCACAAC -3'
Posted On2016-06-06