Incidental Mutation 'R5091:Sorcs1'
ID 387788
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 042680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R5091 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50143299-50678646 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50259752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000072685
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
Predicted Effect probably null
Transcript: ENSMUST00000209783
Predicted Effect probably null
Transcript: ENSMUST00000211008
Predicted Effect probably null
Transcript: ENSMUST00000211687
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
Dcaf6 T C 1: 165,330,003 D856G possibly damaging Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
R8463:Sorcs1 UTSW 19 50259810 missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50378960 missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50151220 missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50252658 missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50225220 missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50232315 missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50262295 missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50152862 missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50225213 missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50210770 missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50226837 missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAACCCATATGTCCCTACAGG -3'
(R):5'- CGCTACCTGCATCATTCAGG -3'

Sequencing Primer
(F):5'- GCAGGATAAGGACCCGGG -3'
(R):5'- ACCTGCATCATTCAGGTAGGTAGC -3'
Posted On 2016-06-06