Incidental Mutation 'R5091:Sorcs1'
ID 387788
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 042680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5091 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50248190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000072685
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
Predicted Effect probably null
Transcript: ENSMUST00000209783
Predicted Effect probably null
Transcript: ENSMUST00000211008
Predicted Effect probably null
Transcript: ENSMUST00000211687
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,701,057 (GRCm39) S174P probably damaging Het
4931414P19Rik T C 14: 54,823,168 (GRCm39) E343G probably damaging Het
Abca14 T C 7: 119,851,497 (GRCm39) V825A probably damaging Het
Abca8b G T 11: 109,827,210 (GRCm39) T1466K possibly damaging Het
Adcy8 A G 15: 64,678,553 (GRCm39) S467P probably damaging Het
Agbl4 T C 4: 110,976,237 (GRCm39) V198A possibly damaging Het
Agpat4 A G 17: 12,417,699 (GRCm39) K80R probably benign Het
Akap8 T C 17: 32,535,208 (GRCm39) T269A probably benign Het
Ankhd1 A T 18: 36,758,080 (GRCm39) I925F possibly damaging Het
Aste1 A G 9: 105,282,203 (GRCm39) Y57C probably damaging Het
Axdnd1 A G 1: 156,247,980 (GRCm39) S7P possibly damaging Het
BC051019 T A 7: 109,319,789 (GRCm39) R91S probably null Het
Cavin2 C A 1: 51,340,398 (GRCm39) N358K probably benign Het
Cd2 T C 3: 101,190,355 (GRCm39) N196S probably benign Het
Clca3a1 C T 3: 144,436,483 (GRCm39) V867I probably benign Het
Col6a4 T A 9: 105,952,262 (GRCm39) K545N probably damaging Het
Cps1 T A 1: 67,268,679 (GRCm39) probably null Het
Cyp2c65 A T 19: 39,076,009 (GRCm39) probably null Het
Dcaf6 T C 1: 165,157,572 (GRCm39) D856G possibly damaging Het
Epcam T C 17: 87,949,580 (GRCm39) I181T probably damaging Het
Esrp2 A G 8: 106,859,061 (GRCm39) S562P probably damaging Het
Fcgbpl1 A C 7: 27,856,383 (GRCm39) I2057L probably benign Het
Ffar4 A G 19: 38,085,627 (GRCm39) D18G probably benign Het
Gen1 C T 12: 11,296,347 (GRCm39) V337I probably damaging Het
Gimap8 C T 6: 48,633,581 (GRCm39) P467S possibly damaging Het
Gnl3 T A 14: 30,738,803 (GRCm39) H82L possibly damaging Het
Grid2 T C 6: 64,053,862 (GRCm39) S354P probably benign Het
Ighmbp2 T A 19: 3,315,084 (GRCm39) T779S possibly damaging Het
Ints15 C T 5: 143,293,443 (GRCm39) E345K possibly damaging Het
Kif19a C A 11: 114,673,923 (GRCm39) T348N probably damaging Het
Lrrc15 T A 16: 30,092,172 (GRCm39) N389I probably damaging Het
Mrps26 A G 2: 130,405,886 (GRCm39) Y63C probably damaging Het
Myd88 C A 9: 119,166,889 (GRCm39) V223F possibly damaging Het
Nox4 T A 7: 87,025,450 (GRCm39) W526R probably damaging Het
Nrg2 A T 18: 36,185,838 (GRCm39) N300K probably damaging Het
Nsmf T C 2: 24,950,464 (GRCm39) probably benign Het
Patl2 A C 2: 121,954,283 (GRCm39) H429Q probably benign Het
Pcdhb12 A T 18: 37,568,907 (GRCm39) K18* probably null Het
Peg10 T A 6: 4,754,511 (GRCm39) D97E probably benign Het
Runx1t1 C T 4: 13,846,830 (GRCm39) Q205* probably null Het
Selenon T C 4: 134,275,284 (GRCm39) K138R probably damaging Het
Slc13a3 T C 2: 165,262,000 (GRCm39) E369G probably benign Het
Sptbn4 A T 7: 27,068,816 (GRCm39) M499K probably damaging Het
Sra1 A T 18: 36,803,012 (GRCm39) probably benign Het
Stra6 T C 9: 58,048,429 (GRCm39) L174P probably damaging Het
Syngr1 T C 15: 80,000,086 (GRCm39) Y66H probably damaging Het
Synpo G T 18: 60,735,831 (GRCm39) S466* probably null Het
Tenm3 T A 8: 48,795,343 (GRCm39) M595L probably benign Het
Tnks T C 8: 35,308,963 (GRCm39) T1099A probably benign Het
Tram1l1 G T 3: 124,115,400 (GRCm39) V187F possibly damaging Het
Trappc11 T C 8: 47,965,639 (GRCm39) E529G probably benign Het
Usp17la T C 7: 104,510,139 (GRCm39) V248A probably damaging Het
Virma T C 4: 11,519,392 (GRCm39) Y880H probably benign Het
Vmn1r214 C T 13: 23,219,571 (GRCm39) T355I possibly damaging Het
Vmn2r7 T C 3: 64,598,205 (GRCm39) K784R possibly damaging Het
Wrap53 C T 11: 69,453,273 (GRCm39) W389* probably null Het
Zfp748 A G 13: 67,689,638 (GRCm39) S541P probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTAACCCATATGTCCCTACAGG -3'
(R):5'- CGCTACCTGCATCATTCAGG -3'

Sequencing Primer
(F):5'- GCAGGATAAGGACCCGGG -3'
(R):5'- ACCTGCATCATTCAGGTAGGTAGC -3'
Posted On 2016-06-06