Incidental Mutation 'R5092:Igfn1'
ID387794
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
Synonyms9830123M21Rik
MMRRC Submission 042681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5092 (G1)
Quality Score188
Status Not validated
Chromosome1
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135964826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2185 (N2185K)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect unknown
Transcript: ENSMUST00000124134
AA Change: N569K
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: N569K

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140703
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: N2185K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: N2185K

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017 utr 3 prime probably benign
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1626:Igfn1 UTSW 1 135968967 missense probably benign 0.29
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R1984:Igfn1 UTSW 1 135962044 missense probably benign 0.39
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135998625 missense probably benign
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R5966:Igfn1 UTSW 1 135965414 missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
R7105:Igfn1 UTSW 1 135984218 missense probably benign 0.11
R7114:Igfn1 UTSW 1 135966781 missense probably benign 0.01
R7233:Igfn1 UTSW 1 135970135 missense probably benign 0.41
R7276:Igfn1 UTSW 1 135998638 missense possibly damaging 0.85
R7354:Igfn1 UTSW 1 135976032 missense possibly damaging 0.72
R7358:Igfn1 UTSW 1 135964000 missense probably damaging 1.00
R7380:Igfn1 UTSW 1 135962008 missense probably damaging 1.00
R7389:Igfn1 UTSW 1 135967047 missense probably benign 0.00
R7513:Igfn1 UTSW 1 135959967 missense probably damaging 1.00
R7718:Igfn1 UTSW 1 135969036 missense probably benign
R7769:Igfn1 UTSW 1 135982405 missense possibly damaging 0.85
R7810:Igfn1 UTSW 1 135974789 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGCTAGCAGAGTCCATCC -3'
(R):5'- CCAGAACTTGGTCCTCTCTG -3'

Sequencing Primer
(F):5'- AACAGGCAGGGTCAGCACC -3'
(R):5'- GCCAGTCACCGTGAAAAT -3'
Posted On2016-06-06