Incidental Mutation 'R5092:Or8k21'
ID 387799
Institutional Source Beutler Lab
Gene Symbol Or8k21
Ensembl Gene ENSMUSG00000075192
Gene Name olfactory receptor family 8 subfamily K member 21
Synonyms GA_x6K02T2Q125-47793414-47792471, MOR187-4, Olfr1053-ps1, Olfr1053
MMRRC Submission 042681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5092 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86144687-86145628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86144706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 308 (Q308R)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
AlphaFold L7MU59
Predicted Effect probably benign
Transcript: ENSMUST00000099897
AA Change: Q308R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: Q308R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,637,091 (GRCm39) probably benign Het
Abca13 T A 11: 9,208,535 (GRCm39) L236Q probably damaging Het
Acp2 A T 2: 91,038,391 (GRCm39) T255S probably benign Het
Acsf3 A C 8: 123,544,131 (GRCm39) R536S probably benign Het
Adgrb1 T G 15: 74,401,664 (GRCm39) V220G probably benign Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Atp5f1b A G 10: 127,919,854 (GRCm39) Q74R probably benign Het
Bltp1 A T 3: 37,054,234 (GRCm39) M3118L probably benign Het
Brf1 G A 12: 112,943,352 (GRCm39) T166M probably damaging Het
Capn9 A G 8: 125,324,264 (GRCm39) K188R probably damaging Het
Casp8 A T 1: 58,883,835 (GRCm39) N381Y possibly damaging Het
Ccdc88b A G 19: 6,825,600 (GRCm39) S1218P probably damaging Het
Cdc42bpg C T 19: 6,363,250 (GRCm39) P403S probably benign Het
Cdkal1 T A 13: 30,030,222 (GRCm39) Y91F probably damaging Het
Cdyl2 T C 8: 117,350,679 (GRCm39) N151D possibly damaging Het
Cnot1 T A 8: 96,479,396 (GRCm39) R875S possibly damaging Het
Cpd A G 11: 76,702,530 (GRCm39) S613P possibly damaging Het
Cyp2e1 G T 7: 140,354,648 (GRCm39) R492L probably damaging Het
D5Ertd579e G A 5: 36,760,047 (GRCm39) T1371M probably benign Het
Dcaf8 A G 1: 172,014,476 (GRCm39) T394A probably benign Het
Dgka T C 10: 128,571,702 (GRCm39) E117G probably damaging Het
Dock4 G A 12: 40,894,440 (GRCm39) V1867I probably benign Het
E2f2 G T 4: 135,914,248 (GRCm39) A333S probably benign Het
Eif3l T C 15: 78,968,354 (GRCm39) S208P probably benign Het
Elovl3 A T 19: 46,122,961 (GRCm39) H179L probably damaging Het
Eml5 T C 12: 98,758,875 (GRCm39) D1766G probably damaging Het
Eno4 A G 19: 58,934,023 (GRCm39) T75A probably benign Het
Fam135a C T 1: 24,067,888 (GRCm39) D94N probably benign Het
Fasn G T 11: 120,705,862 (GRCm39) Q1136K probably benign Het
Fcer1a T G 1: 173,053,022 (GRCm39) N58T probably damaging Het
Frmd4b T A 6: 97,272,941 (GRCm39) D763V probably damaging Het
Gm43518 A G 5: 124,076,297 (GRCm39) T115A probably damaging Het
Gria4 C T 9: 4,472,176 (GRCm39) E438K probably benign Het
Grin2d T C 7: 45,503,692 (GRCm39) E681G probably damaging Het
Gtf3c5 G T 2: 28,472,885 (GRCm39) N35K possibly damaging Het
Hydin A G 8: 111,309,300 (GRCm39) T4031A probably benign Het
Igfn1 G T 1: 135,892,564 (GRCm39) N2185K probably benign Het
Il17rb T C 14: 29,724,333 (GRCm39) T174A probably benign Het
Kdm3b T A 18: 34,946,515 (GRCm39) C835S probably benign Het
Lgi2 A T 5: 52,695,429 (GRCm39) I510N probably damaging Het
Map3k6 A G 4: 132,979,054 (GRCm39) E1164G probably benign Het
Mpv17l T A 16: 13,758,537 (GRCm39) M1K probably null Het
Myoc T A 1: 162,467,203 (GRCm39) L124Q probably damaging Het
Nbeal2 C A 9: 110,455,796 (GRCm39) probably null Het
Nek10 A G 14: 14,820,851 (GRCm38) K13E possibly damaging Het
Nt5dc2 A G 14: 30,860,989 (GRCm39) H491R possibly damaging Het
Or4f61 A C 2: 111,922,452 (GRCm39) M198R possibly damaging Het
Or51b6 T A 7: 103,556,406 (GRCm39) Y250* probably null Het
Pclo T A 5: 14,727,322 (GRCm39) probably benign Het
Pgm2 A T 5: 64,265,092 (GRCm39) N371I possibly damaging Het
Phf20l1 T A 15: 66,508,762 (GRCm39) S873T possibly damaging Het
Plch1 T C 3: 63,606,131 (GRCm39) T1249A probably benign Het
Plekhn1 A T 4: 156,309,222 (GRCm39) I228N possibly damaging Het
Ppp1r12a A T 10: 108,103,263 (GRCm39) probably null Het
Ptchd3 T C 11: 121,721,972 (GRCm39) Y282H probably damaging Het
Ptprk T A 10: 28,468,769 (GRCm39) N1396K probably damaging Het
Rap1gap2 T C 11: 74,329,121 (GRCm39) E81G probably damaging Het
Rpf2 T C 10: 40,122,971 (GRCm39) M1V probably null Het
Rpgrip1l G A 8: 91,948,012 (GRCm39) Q1224* probably null Het
Rreb1 A G 13: 38,112,254 (GRCm39) D286G probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Senp5 A T 16: 31,807,960 (GRCm39) N431K probably benign Het
Serpina1f A C 12: 103,659,809 (GRCm39) S158A probably damaging Het
Sertad3 T A 7: 27,176,145 (GRCm39) I193N probably damaging Het
Slc22a8 T A 19: 8,571,528 (GRCm39) N86K probably damaging Het
Slc6a2 T C 8: 93,721,347 (GRCm39) V492A possibly damaging Het
Slf2 T A 19: 44,940,523 (GRCm39) D773E probably benign Het
Slmap A C 14: 26,184,744 (GRCm39) L272R probably damaging Het
Smyd5 T C 6: 85,422,185 (GRCm39) probably benign Het
Snx21 G T 2: 164,628,666 (GRCm39) R103L probably damaging Het
Sphk2 T A 7: 45,361,777 (GRCm39) probably null Het
Stab1 T C 14: 30,867,812 (GRCm39) K1653E probably benign Het
Syde1 A G 10: 78,425,252 (GRCm39) V253A probably benign Het
Sympk G T 7: 18,776,584 (GRCm39) R492L probably benign Het
Taar7f T C 10: 23,925,451 (GRCm39) I15T probably benign Het
Tas2r140 A G 6: 40,468,200 (GRCm39) D10G probably benign Het
Tbcc A G 17: 47,202,600 (GRCm39) S329G probably benign Het
Teddm3 G A 16: 20,971,900 (GRCm39) T223M probably benign Het
Tex14 G T 11: 87,405,668 (GRCm39) C860F probably benign Het
Thada A T 17: 84,751,896 (GRCm39) L360Q probably damaging Het
Thop1 C A 10: 80,916,412 (GRCm39) H473Q probably damaging Het
Tln2 T C 9: 67,163,310 (GRCm39) D1075G probably benign Het
Tmem130 G A 5: 144,680,528 (GRCm39) T292I probably benign Het
Tmem198b T C 10: 128,637,305 (GRCm39) N278S probably benign Het
Ttc21a A T 9: 119,771,731 (GRCm39) T177S probably benign Het
Ubr2 A T 17: 47,280,173 (GRCm39) C659S probably damaging Het
Vmn2r4 T C 3: 64,298,373 (GRCm39) K585R probably benign Het
Vmn2r86 A G 10: 130,282,456 (GRCm39) I720T probably damaging Het
Wdr35 G T 12: 9,037,327 (GRCm39) W311L probably damaging Het
Zfp39 A T 11: 58,782,028 (GRCm39) F245I possibly damaging Het
Zftraf1 A T 15: 76,530,512 (GRCm39) F269L probably benign Het
Zmym5 G A 14: 57,034,236 (GRCm39) T325I probably benign Het
Zng1 A T 19: 24,898,383 (GRCm39) probably null Het
Other mutations in Or8k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Or8k21 APN 2 86,145,288 (GRCm39) missense probably damaging 1.00
IGL02063:Or8k21 APN 2 86,145,137 (GRCm39) missense possibly damaging 0.50
IGL02503:Or8k21 APN 2 86,144,983 (GRCm39) missense possibly damaging 0.71
IGL03342:Or8k21 APN 2 86,145,579 (GRCm39) missense possibly damaging 0.85
PIT4520001:Or8k21 UTSW 2 86,145,142 (GRCm39) missense possibly damaging 0.78
R0562:Or8k21 UTSW 2 86,144,869 (GRCm39) missense probably benign 0.00
R1026:Or8k21 UTSW 2 86,145,558 (GRCm39) missense possibly damaging 0.80
R1134:Or8k21 UTSW 2 86,145,525 (GRCm39) missense probably damaging 1.00
R1200:Or8k21 UTSW 2 86,145,477 (GRCm39) missense probably damaging 0.99
R1566:Or8k21 UTSW 2 86,145,129 (GRCm39) missense probably benign 0.01
R1588:Or8k21 UTSW 2 86,144,874 (GRCm39) missense probably damaging 1.00
R1747:Or8k21 UTSW 2 86,145,211 (GRCm39) missense probably benign 0.00
R1951:Or8k21 UTSW 2 86,145,504 (GRCm39) missense probably damaging 1.00
R1975:Or8k21 UTSW 2 86,145,498 (GRCm39) missense probably damaging 0.99
R2291:Or8k21 UTSW 2 86,145,524 (GRCm39) nonsense probably null
R2425:Or8k21 UTSW 2 86,144,739 (GRCm39) missense probably damaging 0.98
R5651:Or8k21 UTSW 2 86,144,784 (GRCm39) missense probably benign 0.23
R5733:Or8k21 UTSW 2 86,145,558 (GRCm39) missense probably damaging 0.98
R5767:Or8k21 UTSW 2 86,144,742 (GRCm39) missense probably damaging 1.00
R6307:Or8k21 UTSW 2 86,145,468 (GRCm39) missense probably benign
R6720:Or8k21 UTSW 2 86,145,409 (GRCm39) missense probably damaging 0.99
R7067:Or8k21 UTSW 2 86,144,911 (GRCm39) missense probably damaging 1.00
R7289:Or8k21 UTSW 2 86,145,369 (GRCm39) missense probably benign 0.00
R7604:Or8k21 UTSW 2 86,145,244 (GRCm39) missense probably damaging 1.00
R7773:Or8k21 UTSW 2 86,145,034 (GRCm39) missense probably benign 0.01
R8345:Or8k21 UTSW 2 86,145,451 (GRCm39) missense probably damaging 1.00
R9246:Or8k21 UTSW 2 86,145,222 (GRCm39) missense probably damaging 0.99
R9454:Or8k21 UTSW 2 86,145,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTACAGTGCTAGATATAACG -3'
(R):5'- ACATGTGGGTCTCATTTGACAG -3'

Sequencing Primer
(F):5'- AGTGCTAGATATAACGAAAATTCTGG -3'
(R):5'- CTCATTTGACAGTGGTTGTGG -3'
Posted On 2016-06-06