Incidental Mutation 'R5092:Anks6'
ID 387806
Institutional Source Beutler Lab
Gene Symbol Anks6
Ensembl Gene ENSMUSG00000066191
Gene Name ankyrin repeat and sterile alpha motif domain containing 6
Synonyms SamCystin, 2210417J20Rik, Samd6, b2b1801.1Clo, LOC269533
MMRRC Submission 042681-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5092 (G1)
Quality Score 175
Status Not validated
Chromosome 4
Chromosomal Location 47015669-47057427 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47030795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 601 (G601S)
Ref Sequence ENSEMBL: ENSMUSP00000081665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]
AlphaFold Q6GQX6
Predicted Effect probably damaging
Transcript: ENSMUST00000084616
AA Change: G601S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: G601S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 539 575 N/A INTRINSIC
low complexity region 619 673 N/A INTRINSIC
SAM 700 766 2.73e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107747
AA Change: G669S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: G669S

DomainStartEndE-ValueType
ANK 8 37 2.39e2 SMART
ANK 68 97 5.62e-4 SMART
ANK 101 130 2.05e-6 SMART
ANK 134 163 1.9e-1 SMART
ANK 181 210 8.99e-3 SMART
ANK 215 244 7.83e-3 SMART
ANK 282 312 5.87e2 SMART
ANK 316 345 1.22e-4 SMART
ANK 350 379 3.57e-6 SMART
ANK 383 414 1.23e3 SMART
low complexity region 607 643 N/A INTRINSIC
low complexity region 687 741 N/A INTRINSIC
low complexity region 748 768 N/A INTRINSIC
Blast:SAM 769 796 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229609
AA Change: G669S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,637,091 (GRCm39) probably benign Het
Abca13 T A 11: 9,208,535 (GRCm39) L236Q probably damaging Het
Acp2 A T 2: 91,038,391 (GRCm39) T255S probably benign Het
Acsf3 A C 8: 123,544,131 (GRCm39) R536S probably benign Het
Adgrb1 T G 15: 74,401,664 (GRCm39) V220G probably benign Het
Atp5f1b A G 10: 127,919,854 (GRCm39) Q74R probably benign Het
Bltp1 A T 3: 37,054,234 (GRCm39) M3118L probably benign Het
Brf1 G A 12: 112,943,352 (GRCm39) T166M probably damaging Het
Capn9 A G 8: 125,324,264 (GRCm39) K188R probably damaging Het
Casp8 A T 1: 58,883,835 (GRCm39) N381Y possibly damaging Het
Ccdc88b A G 19: 6,825,600 (GRCm39) S1218P probably damaging Het
Cdc42bpg C T 19: 6,363,250 (GRCm39) P403S probably benign Het
Cdkal1 T A 13: 30,030,222 (GRCm39) Y91F probably damaging Het
Cdyl2 T C 8: 117,350,679 (GRCm39) N151D possibly damaging Het
Cnot1 T A 8: 96,479,396 (GRCm39) R875S possibly damaging Het
Cpd A G 11: 76,702,530 (GRCm39) S613P possibly damaging Het
Cyp2e1 G T 7: 140,354,648 (GRCm39) R492L probably damaging Het
D5Ertd579e G A 5: 36,760,047 (GRCm39) T1371M probably benign Het
Dcaf8 A G 1: 172,014,476 (GRCm39) T394A probably benign Het
Dgka T C 10: 128,571,702 (GRCm39) E117G probably damaging Het
Dock4 G A 12: 40,894,440 (GRCm39) V1867I probably benign Het
E2f2 G T 4: 135,914,248 (GRCm39) A333S probably benign Het
Eif3l T C 15: 78,968,354 (GRCm39) S208P probably benign Het
Elovl3 A T 19: 46,122,961 (GRCm39) H179L probably damaging Het
Eml5 T C 12: 98,758,875 (GRCm39) D1766G probably damaging Het
Eno4 A G 19: 58,934,023 (GRCm39) T75A probably benign Het
Fam135a C T 1: 24,067,888 (GRCm39) D94N probably benign Het
Fasn G T 11: 120,705,862 (GRCm39) Q1136K probably benign Het
Fcer1a T G 1: 173,053,022 (GRCm39) N58T probably damaging Het
Frmd4b T A 6: 97,272,941 (GRCm39) D763V probably damaging Het
Gm43518 A G 5: 124,076,297 (GRCm39) T115A probably damaging Het
Gria4 C T 9: 4,472,176 (GRCm39) E438K probably benign Het
Grin2d T C 7: 45,503,692 (GRCm39) E681G probably damaging Het
Gtf3c5 G T 2: 28,472,885 (GRCm39) N35K possibly damaging Het
Hydin A G 8: 111,309,300 (GRCm39) T4031A probably benign Het
Igfn1 G T 1: 135,892,564 (GRCm39) N2185K probably benign Het
Il17rb T C 14: 29,724,333 (GRCm39) T174A probably benign Het
Kdm3b T A 18: 34,946,515 (GRCm39) C835S probably benign Het
Lgi2 A T 5: 52,695,429 (GRCm39) I510N probably damaging Het
Map3k6 A G 4: 132,979,054 (GRCm39) E1164G probably benign Het
Mpv17l T A 16: 13,758,537 (GRCm39) M1K probably null Het
Myoc T A 1: 162,467,203 (GRCm39) L124Q probably damaging Het
Nbeal2 C A 9: 110,455,796 (GRCm39) probably null Het
Nek10 A G 14: 14,820,851 (GRCm38) K13E possibly damaging Het
Nt5dc2 A G 14: 30,860,989 (GRCm39) H491R possibly damaging Het
Or4f61 A C 2: 111,922,452 (GRCm39) M198R possibly damaging Het
Or51b6 T A 7: 103,556,406 (GRCm39) Y250* probably null Het
Or8k21 T C 2: 86,144,706 (GRCm39) Q308R probably benign Het
Pclo T A 5: 14,727,322 (GRCm39) probably benign Het
Pgm2 A T 5: 64,265,092 (GRCm39) N371I possibly damaging Het
Phf20l1 T A 15: 66,508,762 (GRCm39) S873T possibly damaging Het
Plch1 T C 3: 63,606,131 (GRCm39) T1249A probably benign Het
Plekhn1 A T 4: 156,309,222 (GRCm39) I228N possibly damaging Het
Ppp1r12a A T 10: 108,103,263 (GRCm39) probably null Het
Ptchd3 T C 11: 121,721,972 (GRCm39) Y282H probably damaging Het
Ptprk T A 10: 28,468,769 (GRCm39) N1396K probably damaging Het
Rap1gap2 T C 11: 74,329,121 (GRCm39) E81G probably damaging Het
Rpf2 T C 10: 40,122,971 (GRCm39) M1V probably null Het
Rpgrip1l G A 8: 91,948,012 (GRCm39) Q1224* probably null Het
Rreb1 A G 13: 38,112,254 (GRCm39) D286G probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Senp5 A T 16: 31,807,960 (GRCm39) N431K probably benign Het
Serpina1f A C 12: 103,659,809 (GRCm39) S158A probably damaging Het
Sertad3 T A 7: 27,176,145 (GRCm39) I193N probably damaging Het
Slc22a8 T A 19: 8,571,528 (GRCm39) N86K probably damaging Het
Slc6a2 T C 8: 93,721,347 (GRCm39) V492A possibly damaging Het
Slf2 T A 19: 44,940,523 (GRCm39) D773E probably benign Het
Slmap A C 14: 26,184,744 (GRCm39) L272R probably damaging Het
Smyd5 T C 6: 85,422,185 (GRCm39) probably benign Het
Snx21 G T 2: 164,628,666 (GRCm39) R103L probably damaging Het
Sphk2 T A 7: 45,361,777 (GRCm39) probably null Het
Stab1 T C 14: 30,867,812 (GRCm39) K1653E probably benign Het
Syde1 A G 10: 78,425,252 (GRCm39) V253A probably benign Het
Sympk G T 7: 18,776,584 (GRCm39) R492L probably benign Het
Taar7f T C 10: 23,925,451 (GRCm39) I15T probably benign Het
Tas2r140 A G 6: 40,468,200 (GRCm39) D10G probably benign Het
Tbcc A G 17: 47,202,600 (GRCm39) S329G probably benign Het
Teddm3 G A 16: 20,971,900 (GRCm39) T223M probably benign Het
Tex14 G T 11: 87,405,668 (GRCm39) C860F probably benign Het
Thada A T 17: 84,751,896 (GRCm39) L360Q probably damaging Het
Thop1 C A 10: 80,916,412 (GRCm39) H473Q probably damaging Het
Tln2 T C 9: 67,163,310 (GRCm39) D1075G probably benign Het
Tmem130 G A 5: 144,680,528 (GRCm39) T292I probably benign Het
Tmem198b T C 10: 128,637,305 (GRCm39) N278S probably benign Het
Ttc21a A T 9: 119,771,731 (GRCm39) T177S probably benign Het
Ubr2 A T 17: 47,280,173 (GRCm39) C659S probably damaging Het
Vmn2r4 T C 3: 64,298,373 (GRCm39) K585R probably benign Het
Vmn2r86 A G 10: 130,282,456 (GRCm39) I720T probably damaging Het
Wdr35 G T 12: 9,037,327 (GRCm39) W311L probably damaging Het
Zfp39 A T 11: 58,782,028 (GRCm39) F245I possibly damaging Het
Zftraf1 A T 15: 76,530,512 (GRCm39) F269L probably benign Het
Zmym5 G A 14: 57,034,236 (GRCm39) T325I probably benign Het
Zng1 A T 19: 24,898,383 (GRCm39) probably null Het
Other mutations in Anks6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Anks6 APN 4 47,046,054 (GRCm39) missense probably damaging 0.98
IGL01886:Anks6 APN 4 47,044,850 (GRCm39) missense probably damaging 1.00
IGL02903:Anks6 APN 4 47,045,004 (GRCm39) missense probably damaging 1.00
PIT4131001:Anks6 UTSW 4 47,027,109 (GRCm39) missense probably damaging 1.00
R0632:Anks6 UTSW 4 47,033,167 (GRCm39) missense possibly damaging 0.95
R1220:Anks6 UTSW 4 47,025,767 (GRCm39) splice site probably benign
R1398:Anks6 UTSW 4 47,044,926 (GRCm39) missense possibly damaging 0.75
R1479:Anks6 UTSW 4 47,044,874 (GRCm39) missense probably damaging 1.00
R1519:Anks6 UTSW 4 47,027,152 (GRCm39) missense probably damaging 0.99
R1713:Anks6 UTSW 4 47,039,726 (GRCm39) missense probably benign 0.00
R1781:Anks6 UTSW 4 47,043,639 (GRCm39) missense possibly damaging 0.87
R1853:Anks6 UTSW 4 47,049,387 (GRCm39) missense probably benign 0.00
R2364:Anks6 UTSW 4 47,027,248 (GRCm39) missense possibly damaging 0.93
R3790:Anks6 UTSW 4 47,049,212 (GRCm39) missense probably damaging 0.97
R4432:Anks6 UTSW 4 47,044,905 (GRCm39) nonsense probably null
R4700:Anks6 UTSW 4 47,033,127 (GRCm39) missense possibly damaging 0.86
R4847:Anks6 UTSW 4 47,033,266 (GRCm39) missense probably benign
R4876:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4877:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4878:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4879:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4961:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4962:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4968:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4970:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R4971:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R5113:Anks6 UTSW 4 47,030,795 (GRCm39) missense probably damaging 1.00
R5389:Anks6 UTSW 4 47,038,900 (GRCm39) splice site probably benign
R5569:Anks6 UTSW 4 47,045,007 (GRCm39) missense probably damaging 1.00
R5857:Anks6 UTSW 4 47,039,736 (GRCm39) missense possibly damaging 0.92
R5977:Anks6 UTSW 4 47,035,748 (GRCm39) missense probably benign 0.11
R5978:Anks6 UTSW 4 47,049,252 (GRCm39) missense probably damaging 1.00
R6933:Anks6 UTSW 4 47,049,164 (GRCm39) missense probably benign 0.25
R7175:Anks6 UTSW 4 47,046,268 (GRCm39) splice site probably null
R7454:Anks6 UTSW 4 47,038,919 (GRCm39) missense unknown
R7874:Anks6 UTSW 4 47,049,275 (GRCm39) missense unknown
R8146:Anks6 UTSW 4 47,043,605 (GRCm39) missense unknown
R8437:Anks6 UTSW 4 47,030,705 (GRCm39) missense probably benign 0.00
R9454:Anks6 UTSW 4 47,016,789 (GRCm39) missense possibly damaging 0.86
R9462:Anks6 UTSW 4 47,033,142 (GRCm39) missense unknown
R9567:Anks6 UTSW 4 47,044,880 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAAAGCACTGTACAGGTGTC -3'
(R):5'- AAGACAAGCCAGCTCTTGCC -3'

Sequencing Primer
(F):5'- ACTGTACAGGTGTCACAGGCATC -3'
(R):5'- GCTTCTCACTATGCCACTTGG -3'
Posted On 2016-06-06