Mutagenetix > Incidental Mutations

Incidental Mutation 'R5092:Rpgrip1l'

387831

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

042681-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 91221384 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1224 (Q1224*)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]

Predicted Effect

probably null
Transcript: ENSMUST00000047783
AA Change: Q1224*

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: Q1224*

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211546

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,987,667		probably benign	Het
4932438A13Rik	A	T	3: 37,000,085	M3118L	probably benign	Het
Abca13	T	A	11: 9,258,535	L236Q	probably damaging	Het
Acp2	A	T	2: 91,208,046	T255S	probably benign	Het
Acsf3	A	C	8: 122,817,392	R536S	probably benign	Het
Adgrb1	T	G	15: 74,529,815	V220G	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atp5b	A	G	10: 128,083,985	Q74R	probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
Capn9	A	G	8: 124,597,525	K188R	probably damaging	Het
Casp8	A	T	1: 58,844,676	N381Y	possibly damaging	Het
Cbwd1	A	T	19: 24,921,019		probably null	Het
Ccdc88b	A	G	19: 6,848,232	S1218P	probably damaging	Het
Cdc42bpg	C	T	19: 6,313,220	P403S	probably benign	Het
Cdkal1	T	A	13: 29,846,239	Y91F	probably damaging	Het
Cdyl2	T	C	8: 116,623,940	N151D	possibly damaging	Het
Cnot1	T	A	8: 95,752,768	R875S	possibly damaging	Het
Cpd	A	G	11: 76,811,704	S613P	possibly damaging	Het
Cyhr1	A	T	15: 76,646,312	F269L	probably benign	Het
Cyp2e1	G	T	7: 140,774,735	R492L	probably damaging	Het
D5Ertd579e	G	A	5: 36,602,703	T1371M	probably benign	Het
Dcaf8	A	G	1: 172,186,909	T394A	probably benign	Het
Dgka	T	C	10: 128,735,833	E117G	probably damaging	Het
Dock4	G	A	12: 40,844,441	V1867I	probably benign	Het
E2f2	G	T	4: 136,186,937	A333S	probably benign	Het
Eif3l	T	C	15: 79,084,154	S208P	probably benign	Het
Elovl3	A	T	19: 46,134,522	H179L	probably damaging	Het
Eml5	T	C	12: 98,792,616	D1766G	probably damaging	Het
Eno4	A	G	19: 58,945,591	T75A	probably benign	Het
Fam135a	C	T	1: 24,028,807	D94N	probably benign	Het
Fasn	G	T	11: 120,815,036	Q1136K	probably benign	Het
Fcer1a	T	G	1: 173,225,455	N58T	probably damaging	Het
Frmd4b	T	A	6: 97,295,980	D763V	probably damaging	Het
Gm43518	A	G	5: 123,938,234	T115A	probably damaging	Het
Gria4	C	T	9: 4,472,176	E438K	probably benign	Het
Grin2d	T	C	7: 45,854,268	E681G	probably damaging	Het
Gtf3c5	G	T	2: 28,582,873	N35K	possibly damaging	Het
Hydin	A	G	8: 110,582,668	T4031A	probably benign	Het
Igfn1	G	T	1: 135,964,826	N2185K	probably benign	Het
Il17rb	T	C	14: 30,002,376	T174A	probably benign	Het
Kdm3b	T	A	18: 34,813,462	C835S	probably benign	Het
Lgi2	A	T	5: 52,538,087	I510N	probably damaging	Het
Map3k6	A	G	4: 133,251,743	E1164G	probably benign	Het
Mpv17l	T	A	16: 13,940,673	M1K	probably null	Het
Myoc	T	A	1: 162,639,634	L124Q	probably damaging	Het
Nbeal2	C	A	9: 110,626,728		probably null	Het
Nek10	A	G	14: 14,820,851	K13E	possibly damaging	Het
Nt5dc2	A	G	14: 31,139,032	H491R	possibly damaging	Het
Olfr1053	T	C	2: 86,314,362	Q308R	probably benign	Het
Olfr1314	A	C	2: 112,092,107	M198R	possibly damaging	Het
Olfr65	T	A	7: 103,907,199	Y250*	probably null	Het
Pclo	T	A	5: 14,677,308		probably benign	Het
Pgm1	A	T	5: 64,107,749	N371I	possibly damaging	Het
Phf20l1	T	A	15: 66,636,913	S873T	possibly damaging	Het
Plch1	T	C	3: 63,698,710	T1249A	probably benign	Het
Plekhn1	A	T	4: 156,224,765	I228N	possibly damaging	Het
Ppp1r12a	A	T	10: 108,267,402		probably null	Het
Ptchd3	T	C	11: 121,831,146	Y282H	probably damaging	Het
Ptprk	T	A	10: 28,592,773	N1396K	probably damaging	Het
Rap1gap2	T	C	11: 74,438,295	E81G	probably damaging	Het
Rpf2	T	C	10: 40,246,975	M1V	probably null	Het
Rreb1	A	G	13: 37,928,278	D286G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Senp5	A	T	16: 31,989,142	N431K	probably benign	Het
Serpina1f	A	C	12: 103,693,550	S158A	probably damaging	Het
Sertad3	T	A	7: 27,476,720	I193N	probably damaging	Het
Slc22a8	T	A	19: 8,594,164	N86K	probably damaging	Het
Slc6a2	T	C	8: 92,994,719	V492A	possibly damaging	Het
Slf2	T	A	19: 44,952,084	D773E	probably benign	Het
Slmap	A	C	14: 26,463,589	L272R	probably damaging	Het
Smyd5	T	C	6: 85,445,203		probably benign	Het
Snx21	G	T	2: 164,786,746	R103L	probably damaging	Het
Sphk2	T	A	7: 45,712,353		probably null	Het
Stab1	T	C	14: 31,145,855	K1653E	probably benign	Het
Syde1	A	G	10: 78,589,418	V253A	probably benign	Het
Sympk	G	T	7: 19,042,659	R492L	probably benign	Het
Taar7f	T	C	10: 24,049,553	I15T	probably benign	Het
Tas2r137	A	G	6: 40,491,266	D10G	probably benign	Het
Tbcc	A	G	17: 46,891,674	S329G	probably benign	Het
Teddm3	G	A	16: 21,153,150	T223M	probably benign	Het
Tex14	G	T	11: 87,514,842	C860F	probably benign	Het
Thada	A	T	17: 84,444,468	L360Q	probably damaging	Het
Thop1	C	A	10: 81,080,578	H473Q	probably damaging	Het
Tln2	T	C	9: 67,256,028	D1075G	probably benign	Het
Tmem130	G	A	5: 144,743,718	T292I	probably benign	Het
Tmem198b	T	C	10: 128,801,436	N278S	probably benign	Het
Ttc21a	A	T	9: 119,942,665	T177S	probably benign	Het
Ubr2	A	T	17: 46,969,247	C659S	probably damaging	Het
Vmn2r4	T	C	3: 64,390,952	K585R	probably benign	Het
Vmn2r86	A	G	10: 130,446,587	I720T	probably damaging	Het
Wdr35	G	T	12: 8,987,327	W311L	probably damaging	Het
Zfp39	A	T	11: 58,891,202	F245I	possibly damaging	Het
Zmym5	G	A	14: 56,796,779	T325I	probably benign	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	probably damaging	0.99
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6956:Rpgrip1l	UTSW	8	91286313	splice site	probably null
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
R7064:Rpgrip1l	UTSW	8	91263520	nonsense	probably null
R7145:Rpgrip1l	UTSW	8	91232806	critical splice donor site	probably null
R7243:Rpgrip1l	UTSW	8	91270123	missense	probably benign	0.00
R7673:Rpgrip1l	UTSW	8	91300787	missense	possibly damaging	0.89
R7796:Rpgrip1l	UTSW	8	91270237	missense	probably damaging	1.00
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCCCCATCACTAAGAAATGCATTAG -3'
(R):5'- TCACAATGCCCTGCTCCATG -3'

Sequencing Primer
(F):5'- TTCTCTATCAGGCACAGAAGGG -3'
(R):5'- AATGCCCTGCTCCATGGTAGTG -3'

Posted On

2016-06-06