Incidental Mutation 'R5092:Cnot1'
ID387833
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 042681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5092 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95752768 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 875 (R875S)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: R870S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: R870S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083277
Predicted Effect possibly damaging
Transcript: ENSMUST00000098473
AA Change: R875S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: R875S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197815
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: R868S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211937
Predicted Effect unknown
Transcript: ENSMUST00000211973
AA Change: R342S
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: R875S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Syde1 A G 10: 78,589,418 V253A probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAATGCCATGTAAGTGACCAG -3'
(R):5'- TGAGGTGAGTGTCTAGGATCCC -3'

Sequencing Primer
(F):5'- AGTGACCAGTCCTTTTTCAATTATGC -3'
(R):5'- TGAGTGTCTAGGATCCCTAATTTC -3'
Posted On2016-06-06