Mutagenetix > Incidental Mutation

Incidental Mutation 'R5092:Cnot1'

387833

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

042681-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95752768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 875 (R875S)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: R870S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: R870S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083277

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: R875S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: R875S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197815

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: R868S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211937

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: R342S

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: R875S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,987,667		probably benign	Het
4932438A13Rik	A	T	3: 37,000,085	M3118L	probably benign	Het
Abca13	T	A	11: 9,258,535	L236Q	probably damaging	Het
Acp2	A	T	2: 91,208,046	T255S	probably benign	Het
Acsf3	A	C	8: 122,817,392	R536S	probably benign	Het
Adgrb1	T	G	15: 74,529,815	V220G	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atp5b	A	G	10: 128,083,985	Q74R	probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
Capn9	A	G	8: 124,597,525	K188R	probably damaging	Het
Casp8	A	T	1: 58,844,676	N381Y	possibly damaging	Het
Cbwd1	A	T	19: 24,921,019		probably null	Het
Ccdc88b	A	G	19: 6,848,232	S1218P	probably damaging	Het
Cdc42bpg	C	T	19: 6,313,220	P403S	probably benign	Het
Cdkal1	T	A	13: 29,846,239	Y91F	probably damaging	Het
Cdyl2	T	C	8: 116,623,940	N151D	possibly damaging	Het
Cpd	A	G	11: 76,811,704	S613P	possibly damaging	Het
Cyhr1	A	T	15: 76,646,312	F269L	probably benign	Het
Cyp2e1	G	T	7: 140,774,735	R492L	probably damaging	Het
D5Ertd579e	G	A	5: 36,602,703	T1371M	probably benign	Het
Dcaf8	A	G	1: 172,186,909	T394A	probably benign	Het
Dgka	T	C	10: 128,735,833	E117G	probably damaging	Het
Dock4	G	A	12: 40,844,441	V1867I	probably benign	Het
E2f2	G	T	4: 136,186,937	A333S	probably benign	Het
Eif3l	T	C	15: 79,084,154	S208P	probably benign	Het
Elovl3	A	T	19: 46,134,522	H179L	probably damaging	Het
Eml5	T	C	12: 98,792,616	D1766G	probably damaging	Het
Eno4	A	G	19: 58,945,591	T75A	probably benign	Het
Fam135a	C	T	1: 24,028,807	D94N	probably benign	Het
Fasn	G	T	11: 120,815,036	Q1136K	probably benign	Het
Fcer1a	T	G	1: 173,225,455	N58T	probably damaging	Het
Frmd4b	T	A	6: 97,295,980	D763V	probably damaging	Het
Gm43518	A	G	5: 123,938,234	T115A	probably damaging	Het
Gria4	C	T	9: 4,472,176	E438K	probably benign	Het
Grin2d	T	C	7: 45,854,268	E681G	probably damaging	Het
Gtf3c5	G	T	2: 28,582,873	N35K	possibly damaging	Het
Hydin	A	G	8: 110,582,668	T4031A	probably benign	Het
Igfn1	G	T	1: 135,964,826	N2185K	probably benign	Het
Il17rb	T	C	14: 30,002,376	T174A	probably benign	Het
Kdm3b	T	A	18: 34,813,462	C835S	probably benign	Het
Lgi2	A	T	5: 52,538,087	I510N	probably damaging	Het
Map3k6	A	G	4: 133,251,743	E1164G	probably benign	Het
Mpv17l	T	A	16: 13,940,673	M1K	probably null	Het
Myoc	T	A	1: 162,639,634	L124Q	probably damaging	Het
Nbeal2	C	A	9: 110,626,728		probably null	Het
Nek10	A	G	14: 14,820,851	K13E	possibly damaging	Het
Nt5dc2	A	G	14: 31,139,032	H491R	possibly damaging	Het
Olfr1053	T	C	2: 86,314,362	Q308R	probably benign	Het
Olfr1314	A	C	2: 112,092,107	M198R	possibly damaging	Het
Olfr65	T	A	7: 103,907,199	Y250*	probably null	Het
Pclo	T	A	5: 14,677,308		probably benign	Het
Pgm1	A	T	5: 64,107,749	N371I	possibly damaging	Het
Phf20l1	T	A	15: 66,636,913	S873T	possibly damaging	Het
Plch1	T	C	3: 63,698,710	T1249A	probably benign	Het
Plekhn1	A	T	4: 156,224,765	I228N	possibly damaging	Het
Ppp1r12a	A	T	10: 108,267,402		probably null	Het
Ptchd3	T	C	11: 121,831,146	Y282H	probably damaging	Het
Ptprk	T	A	10: 28,592,773	N1396K	probably damaging	Het
Rap1gap2	T	C	11: 74,438,295	E81G	probably damaging	Het
Rpf2	T	C	10: 40,246,975	M1V	probably null	Het
Rpgrip1l	G	A	8: 91,221,384	Q1224*	probably null	Het
Rreb1	A	G	13: 37,928,278	D286G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Senp5	A	T	16: 31,989,142	N431K	probably benign	Het
Serpina1f	A	C	12: 103,693,550	S158A	probably damaging	Het
Sertad3	T	A	7: 27,476,720	I193N	probably damaging	Het
Slc22a8	T	A	19: 8,594,164	N86K	probably damaging	Het
Slc6a2	T	C	8: 92,994,719	V492A	possibly damaging	Het
Slf2	T	A	19: 44,952,084	D773E	probably benign	Het
Slmap	A	C	14: 26,463,589	L272R	probably damaging	Het
Smyd5	T	C	6: 85,445,203		probably benign	Het
Snx21	G	T	2: 164,786,746	R103L	probably damaging	Het
Sphk2	T	A	7: 45,712,353		probably null	Het
Stab1	T	C	14: 31,145,855	K1653E	probably benign	Het
Syde1	A	G	10: 78,589,418	V253A	probably benign	Het
Sympk	G	T	7: 19,042,659	R492L	probably benign	Het
Taar7f	T	C	10: 24,049,553	I15T	probably benign	Het
Tas2r137	A	G	6: 40,491,266	D10G	probably benign	Het
Tbcc	A	G	17: 46,891,674	S329G	probably benign	Het
Teddm3	G	A	16: 21,153,150	T223M	probably benign	Het
Tex14	G	T	11: 87,514,842	C860F	probably benign	Het
Thada	A	T	17: 84,444,468	L360Q	probably damaging	Het
Thop1	C	A	10: 81,080,578	H473Q	probably damaging	Het
Tln2	T	C	9: 67,256,028	D1075G	probably benign	Het
Tmem130	G	A	5: 144,743,718	T292I	probably benign	Het
Tmem198b	T	C	10: 128,801,436	N278S	probably benign	Het
Ttc21a	A	T	9: 119,942,665	T177S	probably benign	Het
Ubr2	A	T	17: 46,969,247	C659S	probably damaging	Het
Vmn2r4	T	C	3: 64,390,952	K585R	probably benign	Het
Vmn2r86	A	G	10: 130,446,587	I720T	probably damaging	Het
Wdr35	G	T	12: 8,987,327	W311L	probably damaging	Het
Zfp39	A	T	11: 58,891,202	F245I	possibly damaging	Het
Zmym5	G	A	14: 56,796,779	T325I	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CCAATGCCATGTAAGTGACCAG -3'
(R):5'- TGAGGTGAGTGTCTAGGATCCC -3'

Sequencing Primer
(F):5'- AGTGACCAGTCCTTTTTCAATTATGC -3'
(R):5'- TGAGTGTCTAGGATCCCTAATTTC -3'

Posted On

2016-06-06