Mutagenetix > Incidental Mutations

Incidental Mutation 'R5092:Gria4'

387836

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

042681-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.805) question?

Stock #

R5092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4472176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 438 (E438K)

Ref Sequence

ENSEMBL: ENSMUSP00000066980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: E438K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: E438K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: E438K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: E438K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: E438K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	C	T	7: 40,987,667		probably benign	Het
4932438A13Rik	A	T	3: 37,000,085	M3118L	probably benign	Het
Abca13	T	A	11: 9,258,535	L236Q	probably damaging	Het
Acp2	A	T	2: 91,208,046	T255S	probably benign	Het
Acsf3	A	C	8: 122,817,392	R536S	probably benign	Het
Adgrb1	T	G	15: 74,529,815	V220G	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Atp5b	A	G	10: 128,083,985	Q74R	probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
Capn9	A	G	8: 124,597,525	K188R	probably damaging	Het
Casp8	A	T	1: 58,844,676	N381Y	possibly damaging	Het
Cbwd1	A	T	19: 24,921,019		probably null	Het
Ccdc88b	A	G	19: 6,848,232	S1218P	probably damaging	Het
Cdc42bpg	C	T	19: 6,313,220	P403S	probably benign	Het
Cdkal1	T	A	13: 29,846,239	Y91F	probably damaging	Het
Cdyl2	T	C	8: 116,623,940	N151D	possibly damaging	Het
Cnot1	T	A	8: 95,752,768	R875S	possibly damaging	Het
Cpd	A	G	11: 76,811,704	S613P	possibly damaging	Het
Cyhr1	A	T	15: 76,646,312	F269L	probably benign	Het
Cyp2e1	G	T	7: 140,774,735	R492L	probably damaging	Het
D5Ertd579e	G	A	5: 36,602,703	T1371M	probably benign	Het
Dcaf8	A	G	1: 172,186,909	T394A	probably benign	Het
Dgka	T	C	10: 128,735,833	E117G	probably damaging	Het
Dock4	G	A	12: 40,844,441	V1867I	probably benign	Het
E2f2	G	T	4: 136,186,937	A333S	probably benign	Het
Eif3l	T	C	15: 79,084,154	S208P	probably benign	Het
Elovl3	A	T	19: 46,134,522	H179L	probably damaging	Het
Eml5	T	C	12: 98,792,616	D1766G	probably damaging	Het
Eno4	A	G	19: 58,945,591	T75A	probably benign	Het
Fam135a	C	T	1: 24,028,807	D94N	probably benign	Het
Fasn	G	T	11: 120,815,036	Q1136K	probably benign	Het
Fcer1a	T	G	1: 173,225,455	N58T	probably damaging	Het
Frmd4b	T	A	6: 97,295,980	D763V	probably damaging	Het
Gm43518	A	G	5: 123,938,234	T115A	probably damaging	Het
Grin2d	T	C	7: 45,854,268	E681G	probably damaging	Het
Gtf3c5	G	T	2: 28,582,873	N35K	possibly damaging	Het
Hydin	A	G	8: 110,582,668	T4031A	probably benign	Het
Igfn1	G	T	1: 135,964,826	N2185K	probably benign	Het
Il17rb	T	C	14: 30,002,376	T174A	probably benign	Het
Kdm3b	T	A	18: 34,813,462	C835S	probably benign	Het
Lgi2	A	T	5: 52,538,087	I510N	probably damaging	Het
Map3k6	A	G	4: 133,251,743	E1164G	probably benign	Het
Mpv17l	T	A	16: 13,940,673	M1K	probably null	Het
Myoc	T	A	1: 162,639,634	L124Q	probably damaging	Het
Nbeal2	C	A	9: 110,626,728		probably null	Het
Nek10	A	G	14: 14,820,851	K13E	possibly damaging	Het
Nt5dc2	A	G	14: 31,139,032	H491R	possibly damaging	Het
Olfr1053	T	C	2: 86,314,362	Q308R	probably benign	Het
Olfr1314	A	C	2: 112,092,107	M198R	possibly damaging	Het
Olfr65	T	A	7: 103,907,199	Y250*	probably null	Het
Pclo	T	A	5: 14,677,308		probably benign	Het
Pgm1	A	T	5: 64,107,749	N371I	possibly damaging	Het
Phf20l1	T	A	15: 66,636,913	S873T	possibly damaging	Het
Plch1	T	C	3: 63,698,710	T1249A	probably benign	Het
Plekhn1	A	T	4: 156,224,765	I228N	possibly damaging	Het
Ppp1r12a	A	T	10: 108,267,402		probably null	Het
Ptchd3	T	C	11: 121,831,146	Y282H	probably damaging	Het
Ptprk	T	A	10: 28,592,773	N1396K	probably damaging	Het
Rap1gap2	T	C	11: 74,438,295	E81G	probably damaging	Het
Rpf2	T	C	10: 40,246,975	M1V	probably null	Het
Rpgrip1l	G	A	8: 91,221,384	Q1224*	probably null	Het
Rreb1	A	G	13: 37,928,278	D286G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Senp5	A	T	16: 31,989,142	N431K	probably benign	Het
Serpina1f	A	C	12: 103,693,550	S158A	probably damaging	Het
Sertad3	T	A	7: 27,476,720	I193N	probably damaging	Het
Slc22a8	T	A	19: 8,594,164	N86K	probably damaging	Het
Slc6a2	T	C	8: 92,994,719	V492A	possibly damaging	Het
Slf2	T	A	19: 44,952,084	D773E	probably benign	Het
Slmap	A	C	14: 26,463,589	L272R	probably damaging	Het
Smyd5	T	C	6: 85,445,203		probably benign	Het
Snx21	G	T	2: 164,786,746	R103L	probably damaging	Het
Sphk2	T	A	7: 45,712,353		probably null	Het
Stab1	T	C	14: 31,145,855	K1653E	probably benign	Het
Syde1	A	G	10: 78,589,418	V253A	probably benign	Het
Sympk	G	T	7: 19,042,659	R492L	probably benign	Het
Taar7f	T	C	10: 24,049,553	I15T	probably benign	Het
Tas2r137	A	G	6: 40,491,266	D10G	probably benign	Het
Tbcc	A	G	17: 46,891,674	S329G	probably benign	Het
Teddm3	G	A	16: 21,153,150	T223M	probably benign	Het
Tex14	G	T	11: 87,514,842	C860F	probably benign	Het
Thada	A	T	17: 84,444,468	L360Q	probably damaging	Het
Thop1	C	A	10: 81,080,578	H473Q	probably damaging	Het
Tln2	T	C	9: 67,256,028	D1075G	probably benign	Het
Tmem130	G	A	5: 144,743,718	T292I	probably benign	Het
Tmem198b	T	C	10: 128,801,436	N278S	probably benign	Het
Ttc21a	A	T	9: 119,942,665	T177S	probably benign	Het
Ubr2	A	T	17: 46,969,247	C659S	probably damaging	Het
Vmn2r4	T	C	3: 64,390,952	K585R	probably benign	Het
Vmn2r86	A	G	10: 130,446,587	I720T	probably damaging	Het
Wdr35	G	T	12: 8,987,327	W311L	probably damaging	Het
Zfp39	A	T	11: 58,891,202	F245I	possibly damaging	Het
Zmym5	G	A	14: 56,796,779	T325I	probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGAACACTCATGCCCAAGGG -3'
(R):5'- TTTCTAGCCACACAAAGTCATATGC -3'

Sequencing Primer
(F):5'- AATCTCATAAATCAGCTTGCTTACCC -3'
(R):5'- ACACAAAGTCATATGCATAACAGG -3'

Posted On

2016-06-06