Incidental Mutation 'R5092:Syde1'
ID387844
Institutional Source Beutler Lab
Gene Symbol Syde1
Ensembl Gene ENSMUSG00000032714
Gene Namesynapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms1200008N06Rik, mSYD1A
MMRRC Submission 042681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5092 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78584503-78591964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78589418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 253 (V253A)
Ref Sequence ENSEMBL: ENSMUSP00000043085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040580] [ENSMUST00000105384] [ENSMUST00000218215] [ENSMUST00000218875] [ENSMUST00000218885]
Predicted Effect probably benign
Transcript: ENSMUST00000040580
AA Change: V253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: V253A

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 114 127 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
RhoGAP 411 601 1.49e-56 SMART
low complexity region 638 652 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105384
SMART Domains Protein: ENSMUSP00000101023
Gene: ENSMUSG00000032763

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:TPP_enzyme_N 52 220 1.4e-53 PFAM
Pfam:TPP_enzyme_M 273 405 2.1e-16 PFAM
Pfam:TPP_enzyme_C 467 618 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218641
Predicted Effect probably benign
Transcript: ENSMUST00000218875
Predicted Effect probably benign
Transcript: ENSMUST00000218885
Predicted Effect probably benign
Transcript: ENSMUST00000219588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,987,667 probably benign Het
4932438A13Rik A T 3: 37,000,085 M3118L probably benign Het
Abca13 T A 11: 9,258,535 L236Q probably damaging Het
Acp2 A T 2: 91,208,046 T255S probably benign Het
Acsf3 A C 8: 122,817,392 R536S probably benign Het
Adgrb1 T G 15: 74,529,815 V220G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Atp5b A G 10: 128,083,985 Q74R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
Capn9 A G 8: 124,597,525 K188R probably damaging Het
Casp8 A T 1: 58,844,676 N381Y possibly damaging Het
Cbwd1 A T 19: 24,921,019 probably null Het
Ccdc88b A G 19: 6,848,232 S1218P probably damaging Het
Cdc42bpg C T 19: 6,313,220 P403S probably benign Het
Cdkal1 T A 13: 29,846,239 Y91F probably damaging Het
Cdyl2 T C 8: 116,623,940 N151D possibly damaging Het
Cnot1 T A 8: 95,752,768 R875S possibly damaging Het
Cpd A G 11: 76,811,704 S613P possibly damaging Het
Cyhr1 A T 15: 76,646,312 F269L probably benign Het
Cyp2e1 G T 7: 140,774,735 R492L probably damaging Het
D5Ertd579e G A 5: 36,602,703 T1371M probably benign Het
Dcaf8 A G 1: 172,186,909 T394A probably benign Het
Dgka T C 10: 128,735,833 E117G probably damaging Het
Dock4 G A 12: 40,844,441 V1867I probably benign Het
E2f2 G T 4: 136,186,937 A333S probably benign Het
Eif3l T C 15: 79,084,154 S208P probably benign Het
Elovl3 A T 19: 46,134,522 H179L probably damaging Het
Eml5 T C 12: 98,792,616 D1766G probably damaging Het
Eno4 A G 19: 58,945,591 T75A probably benign Het
Fam135a C T 1: 24,028,807 D94N probably benign Het
Fasn G T 11: 120,815,036 Q1136K probably benign Het
Fcer1a T G 1: 173,225,455 N58T probably damaging Het
Frmd4b T A 6: 97,295,980 D763V probably damaging Het
Gm43518 A G 5: 123,938,234 T115A probably damaging Het
Gria4 C T 9: 4,472,176 E438K probably benign Het
Grin2d T C 7: 45,854,268 E681G probably damaging Het
Gtf3c5 G T 2: 28,582,873 N35K possibly damaging Het
Hydin A G 8: 110,582,668 T4031A probably benign Het
Igfn1 G T 1: 135,964,826 N2185K probably benign Het
Il17rb T C 14: 30,002,376 T174A probably benign Het
Kdm3b T A 18: 34,813,462 C835S probably benign Het
Lgi2 A T 5: 52,538,087 I510N probably damaging Het
Map3k6 A G 4: 133,251,743 E1164G probably benign Het
Mpv17l T A 16: 13,940,673 M1K probably null Het
Myoc T A 1: 162,639,634 L124Q probably damaging Het
Nbeal2 C A 9: 110,626,728 probably null Het
Nek10 A G 14: 14,820,851 K13E possibly damaging Het
Nt5dc2 A G 14: 31,139,032 H491R possibly damaging Het
Olfr1053 T C 2: 86,314,362 Q308R probably benign Het
Olfr1314 A C 2: 112,092,107 M198R possibly damaging Het
Olfr65 T A 7: 103,907,199 Y250* probably null Het
Pclo T A 5: 14,677,308 probably benign Het
Pgm1 A T 5: 64,107,749 N371I possibly damaging Het
Phf20l1 T A 15: 66,636,913 S873T possibly damaging Het
Plch1 T C 3: 63,698,710 T1249A probably benign Het
Plekhn1 A T 4: 156,224,765 I228N possibly damaging Het
Ppp1r12a A T 10: 108,267,402 probably null Het
Ptchd3 T C 11: 121,831,146 Y282H probably damaging Het
Ptprk T A 10: 28,592,773 N1396K probably damaging Het
Rap1gap2 T C 11: 74,438,295 E81G probably damaging Het
Rpf2 T C 10: 40,246,975 M1V probably null Het
Rpgrip1l G A 8: 91,221,384 Q1224* probably null Het
Rreb1 A G 13: 37,928,278 D286G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Senp5 A T 16: 31,989,142 N431K probably benign Het
Serpina1f A C 12: 103,693,550 S158A probably damaging Het
Sertad3 T A 7: 27,476,720 I193N probably damaging Het
Slc22a8 T A 19: 8,594,164 N86K probably damaging Het
Slc6a2 T C 8: 92,994,719 V492A possibly damaging Het
Slf2 T A 19: 44,952,084 D773E probably benign Het
Slmap A C 14: 26,463,589 L272R probably damaging Het
Smyd5 T C 6: 85,445,203 probably benign Het
Snx21 G T 2: 164,786,746 R103L probably damaging Het
Sphk2 T A 7: 45,712,353 probably null Het
Stab1 T C 14: 31,145,855 K1653E probably benign Het
Sympk G T 7: 19,042,659 R492L probably benign Het
Taar7f T C 10: 24,049,553 I15T probably benign Het
Tas2r137 A G 6: 40,491,266 D10G probably benign Het
Tbcc A G 17: 46,891,674 S329G probably benign Het
Teddm3 G A 16: 21,153,150 T223M probably benign Het
Tex14 G T 11: 87,514,842 C860F probably benign Het
Thada A T 17: 84,444,468 L360Q probably damaging Het
Thop1 C A 10: 81,080,578 H473Q probably damaging Het
Tln2 T C 9: 67,256,028 D1075G probably benign Het
Tmem130 G A 5: 144,743,718 T292I probably benign Het
Tmem198b T C 10: 128,801,436 N278S probably benign Het
Ttc21a A T 9: 119,942,665 T177S probably benign Het
Ubr2 A T 17: 46,969,247 C659S probably damaging Het
Vmn2r4 T C 3: 64,390,952 K585R probably benign Het
Vmn2r86 A G 10: 130,446,587 I720T probably damaging Het
Wdr35 G T 12: 8,987,327 W311L probably damaging Het
Zfp39 A T 11: 58,891,202 F245I possibly damaging Het
Zmym5 G A 14: 56,796,779 T325I probably benign Het
Other mutations in Syde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Syde1 APN 10 78585809 missense probably damaging 1.00
IGL01285:Syde1 APN 10 78588887 missense probably damaging 1.00
IGL01529:Syde1 APN 10 78590181 missense probably benign
IGL01869:Syde1 APN 10 78588919 missense possibly damaging 0.93
IGL02098:Syde1 APN 10 78589371 missense probably damaging 1.00
IGL03187:Syde1 APN 10 78589109 missense possibly damaging 0.79
R0014:Syde1 UTSW 10 78590034 missense probably benign
R0561:Syde1 UTSW 10 78589376 missense probably damaging 1.00
R0605:Syde1 UTSW 10 78589095 unclassified probably benign
R1713:Syde1 UTSW 10 78585696 missense probably damaging 1.00
R1756:Syde1 UTSW 10 78586980 missense probably benign
R4491:Syde1 UTSW 10 78590228 missense probably benign 0.00
R4846:Syde1 UTSW 10 78588897 missense probably damaging 0.99
R5287:Syde1 UTSW 10 78590037 missense probably benign
R5611:Syde1 UTSW 10 78585891 missense probably benign
R5951:Syde1 UTSW 10 78589316 missense possibly damaging 0.87
R5957:Syde1 UTSW 10 78590117 missense probably damaging 1.00
R6169:Syde1 UTSW 10 78586104 missense probably damaging 1.00
R7083:Syde1 UTSW 10 78587069 missense probably benign 0.44
R7150:Syde1 UTSW 10 78586198 nonsense probably null
R7239:Syde1 UTSW 10 78588781 missense probably damaging 1.00
R7799:Syde1 UTSW 10 78589907 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTGGTCCGCTTCGAAG -3'
(R):5'- GCCTAAGCCTAAGAAGTACTCG -3'

Sequencing Primer
(F):5'- TTCGAAGTGGCCCTGTGC -3'
(R):5'- GCCTAAGAAGTACTCGCACAGG -3'
Posted On2016-06-06